ID: 929997300

View in Genome Browser
Species Human (GRCh38)
Location 2:46836650-46836672
Sequence CGGTGTCAGCACTTGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929997288_929997300 28 Left 929997288 2:46836599-46836621 CCATTTCACAGATGTAGAAGTTA 0: 1
1: 2
2: 18
3: 229
4: 1405
Right 929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 132
929997287_929997300 29 Left 929997287 2:46836598-46836620 CCCATTTCACAGATGTAGAAGTT 0: 1
1: 3
2: 63
3: 482
4: 2692
Right 929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 132
929997291_929997300 0 Left 929997291 2:46836627-46836649 CCGAGTGGAGAGCCCATTAGTGG 0: 1
1: 1
2: 1
3: 8
4: 121
Right 929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 132
929997286_929997300 30 Left 929997286 2:46836597-46836619 CCCCATTTCACAGATGTAGAAGT 0: 1
1: 1
2: 56
3: 419
4: 2287
Right 929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929997300 Original CRISPR CGGTGTCAGCACTTGGGCTG GGG Intronic
900298479 1:1964803-1964825 AGGTGTCAGGGGTTGGGCTGCGG + Intronic
900500577 1:3002547-3002569 CGATGTCAGGACTTGAGCTGCGG + Intergenic
900593442 1:3469792-3469814 CGGGCTAAGCACTGGGGCTGTGG + Intronic
902154547 1:14473887-14473909 AGGTGCCAGCATTTGAGCTGAGG - Intergenic
903013974 1:20350049-20350071 CGGTGTCTGCAGGTGGGTTGGGG - Intronic
905286031 1:36880916-36880938 AGGGGTCAGCACTGGGGCTGTGG + Intronic
909332568 1:74431567-74431589 AGATGTTAGGACTTGGGCTGAGG - Intronic
910080056 1:83330956-83330978 GGCTGTGAGCGCTTGGGCTGAGG - Intergenic
913538580 1:119797511-119797533 AGGTCTCAGCTATTGGGCTGGGG - Intronic
915596131 1:156897510-156897532 TGGTGCCAGGACTTTGGCTGGGG + Intronic
915634411 1:157176328-157176350 CTGTGTCAGGACTCAGGCTGTGG - Intergenic
917285250 1:173416206-173416228 CAGTGGCAGCAGCTGGGCTGTGG + Intergenic
918458790 1:184754811-184754833 CGGTGGCAGCGCTGGCGCTGGGG - Exonic
920381875 1:205539483-205539505 TGGTGCCAGGACTTAGGCTGAGG - Intergenic
920445373 1:206012313-206012335 GGGTGTAGGCAGTTGGGCTGAGG + Exonic
1065893621 10:30141983-30142005 CGGTGTTAGCACCTGGGAGGTGG + Intergenic
1069850019 10:71398205-71398227 CGCTGACAGCACTAGGGCTGGGG - Intronic
1074939076 10:118217215-118217237 AGATGTCAGAACTTGGGCAGAGG + Intergenic
1075018502 10:118929043-118929065 CTGTGGTACCACTTGGGCTGGGG - Intergenic
1076249469 10:128974002-128974024 CTGTGTCAGCCCTGGTGCTGGGG - Intergenic
1076691191 10:132224623-132224645 CTGTGCCTGCACTTGGGGTGGGG - Intronic
1076791266 10:132777956-132777978 CTGAGCCAGCACCTGGGCTGGGG + Intronic
1076935776 10:133566944-133566966 CGGTGTCAGGGTTTGGGGTGGGG + Intronic
1077134149 11:990376-990398 TGGTGTCAGCACTTGTGGTGGGG + Intronic
1077329003 11:1975841-1975863 GGGACTCAGGACTTGGGCTGGGG - Intronic
1078758709 11:14234638-14234660 CGGAGGCAGCCCTTGGGCGGAGG + Intronic
1079604735 11:22350669-22350691 GGCTGTCAGTAATTGGGCTGGGG - Intronic
1079734333 11:23976623-23976645 GGTTTTCATCACTTGGGCTGTGG - Intergenic
1081042170 11:38225831-38225853 CTGTGTGCCCACTTGGGCTGGGG + Intergenic
1081687032 11:45049932-45049954 CAGTGTCAGCACTGAGACTGTGG + Intergenic
1083463701 11:62831900-62831922 CCGTGTCAGCTCTGGGGCAGTGG - Intronic
1084652534 11:70497631-70497653 CAGAGTCAGCTCATGGGCTGGGG - Intronic
1085329968 11:75640101-75640123 GGTTGTCAGCACTGGGGGTGGGG + Intronic
1089323188 11:117640134-117640156 AGGTCTCAGTGCTTGGGCTGTGG + Intronic
1090421497 11:126578504-126578526 CGGGGTGAGAACTTGGGGTGTGG + Intronic
1202811982 11_KI270721v1_random:31020-31042 GGGACTCAGGACTTGGGCTGGGG - Intergenic
1092312166 12:7369527-7369549 GTGTGTCAGCAGCTGGGCTGTGG - Exonic
1092428556 12:8391893-8391915 TGGTTCCAGCACTTGGGGTGGGG - Intergenic
1096179688 12:49543875-49543897 GGGAGTCAGCACTGGGGCTGGGG - Intronic
1103536820 12:121639000-121639022 GTGTGTCAGCCCTGGGGCTGGGG + Intronic
1104848972 12:131862097-131862119 TGGGGTGAGCACTTGGGCAGAGG + Intergenic
1105937736 13:25117601-25117623 CGGGGGCAGCACTGGGGCGGGGG - Intergenic
1110465337 13:75793628-75793650 TGGTTTGAGCACATGGGCTGTGG + Intronic
1111560932 13:89945625-89945647 GGATGTCAGCACTCGGGATGGGG - Intergenic
1112006686 13:95259553-95259575 AGTTGTCAGGACTTGGGATGGGG - Intronic
1114673987 14:24429265-24429287 CAGTGACAGCAGTTGGGCTTTGG + Exonic
1115475078 14:33805725-33805747 GGTTGCCAGCACTGGGGCTGAGG - Intergenic
1117001762 14:51377424-51377446 TGTTGTCACCACTGGGGCTGGGG + Intergenic
1119014083 14:71031323-71031345 CTGTCCCAGCACTTGGCCTGGGG - Intronic
1119471545 14:74903273-74903295 TGCTGTAAGCACCTGGGCTGAGG + Exonic
1121767916 14:96502981-96503003 CGGGATCAGCACTTGGGGTTCGG + Intronic
1122585110 14:102800522-102800544 GGGTTTCAGCACTGTGGCTGAGG - Intronic
1123923903 15:25090071-25090093 CTGTGTCAACACTTGGGATGGGG + Intergenic
1129539355 15:76338210-76338232 CGGTGTCAGCGCTGGGCCTGCGG - Intronic
1130531328 15:84749152-84749174 CAGGGTCAGAACTTGGGCTCAGG - Intronic
1130660608 15:85828951-85828973 AGGATTCAGCCCTTGGGCTGGGG + Intergenic
1132994282 16:2815010-2815032 CGGGGCCAGCACTTGGGCCATGG - Intergenic
1132996744 16:2827416-2827438 CGGGGCCAGCACTTGGGCCATGG + Intergenic
1133207124 16:4240459-4240481 CCTGCTCAGCACTTGGGCTGTGG - Intronic
1134803168 16:17104190-17104212 CTGTGTCAACACTTGGGATTTGG + Exonic
1136284512 16:29233254-29233276 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1142089547 16:88202767-88202789 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1142755689 17:2015218-2015240 AGGGGTCAGCTCTTGGGCTGGGG + Intronic
1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG + Intronic
1146559077 17:33852620-33852642 AGGAGTCAGCATTTGAGCTGAGG + Intronic
1152404657 17:80089919-80089941 GGGTGCCAGCCCTTGGGCTCTGG + Intronic
1152895954 17:82911313-82911335 CGCTGTCAGCGCCAGGGCTGGGG + Intronic
1153548894 18:6239975-6239997 AGGTGTCAGCACTTAGCCTCTGG + Intronic
1153758163 18:8303932-8303954 CCGTGGCTGCATTTGGGCTGAGG - Intronic
1155130531 18:22930280-22930302 AGGTGGCAGCACTGGGCCTGAGG + Intronic
1160011879 18:75112356-75112378 CCGTGTCAGCAGGTGGGCCGTGG - Intergenic
1161044531 19:2128158-2128180 CCGCCTCAGCACTTGGTCTGAGG + Intronic
1161663286 19:5560241-5560263 CGGGGACAGCACTTGGCCCGGGG - Intergenic
1164683809 19:30153431-30153453 CTGTCTCAGGGCTTGGGCTGGGG - Intergenic
1165468516 19:35989591-35989613 AGGGGTCAGGACTGGGGCTGAGG - Intergenic
1166304511 19:41929831-41929853 CGGTCTCAGCACCTGGGCGCTGG - Intronic
925389365 2:3484898-3484920 CGGTGTAGACACTTGAGCTGTGG - Intronic
927206578 2:20615000-20615022 AGTGGTCAGCACTGGGGCTGGGG + Intronic
927637417 2:24826220-24826242 CGGGGTGAGCTCTAGGGCTGGGG - Intronic
927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG + Intergenic
929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG + Intronic
930229251 2:48827025-48827047 CTGTGTCAGCCTTTGGGCTTTGG + Intergenic
930736621 2:54786481-54786503 CGGTAGCAGCACTTGAGCAGGGG - Intronic
934188207 2:89764211-89764233 AGGTGCCAGCACATGCGCTGGGG + Intergenic
937261771 2:120591278-120591300 GGGTGGCAGGACCTGGGCTGGGG - Intergenic
942151747 2:173082638-173082660 AGGTGTCAGGACTGGGGATGAGG - Intronic
947920421 2:233866570-233866592 TGCTGCCAGCGCTTGGGCTGAGG + Intergenic
948680816 2:239633681-239633703 AGGACTCAGGACTTGGGCTGGGG - Intergenic
948968132 2:241400725-241400747 CTGAGTCAGTACTTGGGGTGGGG - Intronic
1172117033 20:32579179-32579201 CTATGTGAGCACCTGGGCTGTGG - Intronic
1174910339 20:54601152-54601174 CAGAGTGAGCACTGGGGCTGAGG + Intronic
1176025178 20:62982042-62982064 CCGTGACTCCACTTGGGCTGGGG + Intergenic
1176157233 20:63627794-63627816 GGGTGCCAGCTGTTGGGCTGGGG - Intergenic
1176381642 21:6116817-6116839 CGGTTTCGGCACAGGGGCTGTGG - Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179741830 21:43421422-43421444 CGGTTTCGGCACAGGGGCTGTGG + Intronic
1179887967 21:44322489-44322511 CACTGTCAGCACTCTGGCTGAGG + Intronic
1182259846 22:29065784-29065806 GGGTGCCAGCACTTGATCTGGGG + Intergenic
1183748785 22:39707343-39707365 CCGTGTCTGCTCTAGGGCTGCGG + Intergenic
1184201063 22:42970085-42970107 CAGCGTGAGGACTTGGGCTGTGG - Intronic
949376140 3:3392510-3392532 CAGTGCCAGCACTGGGGATGGGG - Intergenic
950358189 3:12429387-12429409 TGGGGTCAGCCCTTGGGCTGAGG - Intronic
952164775 3:30735613-30735635 GGTTGCCAGGACTTGGGCTGAGG + Intronic
952378766 3:32788261-32788283 TGGTGTCATCACTGGGCCTGTGG - Intergenic
954037488 3:47859432-47859454 CTGTGCCAGGCCTTGGGCTGTGG - Intronic
955329124 3:58032358-58032380 CCGTTTCAACACTTGGGGTGGGG - Intronic
955463725 3:59214118-59214140 AGGTGTCAGCCCTTTAGCTGTGG - Intergenic
955479470 3:59374789-59374811 CTGTGTGAGGAATTGGGCTGGGG - Intergenic
956639805 3:71404993-71405015 CAGTGTCAGTCCTTGGGCTGGGG - Intronic
960237465 3:115300398-115300420 TGGTTTCTGCCCTTGGGCTGTGG + Intergenic
968583043 4:1403720-1403742 CGCTGTCCGCGCTCGGGCTGTGG + Exonic
971615761 4:28788879-28788901 AGGGGTCAGCACTTGGGAGGAGG + Intergenic
973996898 4:56467658-56467680 GGGTGTCAGTACCTGCGCTGTGG + Exonic
983710255 4:170706400-170706422 GGGAGTCATCACTTGGGCGGTGG + Intergenic
985992520 5:3575136-3575158 AGGTGCCAGGGCTTGGGCTGTGG - Intergenic
986749640 5:10775700-10775722 CGATGTGAACACTGGGGCTGGGG - Intergenic
999982610 5:156972290-156972312 CAGTTTCAGCAATTGGGCTGTGG + Intergenic
1001970715 5:175953101-175953123 CCTTGGAAGCACTTGGGCTGTGG - Intronic
1002246723 5:177890664-177890686 CCTTGGAAGCACTTGGGCTGTGG + Intergenic
1002717166 5:181234800-181234822 CTCTGTCAGCACTTGGGGGGTGG + Exonic
1006988499 6:38193285-38193307 AGAGGTCAGCACTTGGGCTGGGG + Intronic
1018883907 6:167915574-167915596 CTATGTGAGTACTTGGGCTGCGG + Intronic
1019769123 7:2872239-2872261 GGGTGGCGGTACTTGGGCTGAGG + Intergenic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1024512046 7:50212191-50212213 AGGTGTCAGCACGTGTGCTCTGG + Intergenic
1032784157 7:135187281-135187303 GGATGTCAGCACTGTGGCTGGGG - Intronic
1032838540 7:135696064-135696086 AGGAAACAGCACTTGGGCTGAGG - Intronic
1033822376 7:145149856-145149878 AGTTGTCATCACATGGGCTGTGG - Intergenic
1034689916 7:153006174-153006196 CAGTTTCAGCCCTTTGGCTGAGG - Intergenic
1035421206 7:158730128-158730150 TGGTGTCTGCACATGGGCTGAGG + Intergenic
1036830548 8:12016454-12016476 TGGTTCCAGCACTTGGGGTGGGG - Intergenic
1045330830 8:101154435-101154457 GGGTGTCAGCCCTTGCTCTGTGG + Intergenic
1047207959 8:122818584-122818606 TGGAGACAGCACTTGGCCTGGGG + Intronic
1047997368 8:130349616-130349638 CAGTGGCAACACTTGGGTTGAGG - Intronic
1049562079 8:143316966-143316988 CTGGGGCAGCACTGGGGCTGTGG - Intronic
1051146235 9:14030473-14030495 CGCAGTCTCCACTTGGGCTGGGG + Intergenic
1052049764 9:23831432-23831454 CGGTGCCGGCACTTGCTCTGTGG - Intergenic
1055287044 9:74739836-74739858 AGTCGTCAGCACTTGGTCTGAGG - Exonic
1056493935 9:87137043-87137065 AGGTGTCAGCACTTGGAAGGCGG - Intergenic
1057195148 9:93112395-93112417 CGGTGTCCACACTTGTGCAGTGG + Intronic
1057604148 9:96486798-96486820 CGGTGAAAGCACTTGGGCCAGGG + Intronic
1060671165 9:125471161-125471183 ATGTGTCAGCACTCGGCCTGAGG + Intronic
1062024666 9:134334791-134334813 AGGGGACAGGACTTGGGCTGGGG + Intronic
1062506849 9:136882002-136882024 CGGTGTGAGCAAGTGGACTGCGG + Intronic
1187205277 X:17175912-17175934 CTGTGTCCTCACCTGGGCTGTGG - Intergenic
1197226949 X:123963104-123963126 CGGTGTCAGCACCGCTGCTGGGG + Intronic
1198370754 X:135986149-135986171 CGGTGTCTGGAATTGGGCTGGGG + Intronic
1198428384 X:136542035-136542057 CGGCCTCAGGACTGGGGCTGGGG - Intronic