ID: 929998579

View in Genome Browser
Species Human (GRCh38)
Location 2:46845807-46845829
Sequence TCCCAGGATTTCCCTACCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929998579_929998588 27 Left 929998579 2:46845807-46845829 CCCGGGGTAGGGAAATCCTGGGA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 929998588 2:46845857-46845879 CATGGTTCTAAGTTAGATTTTGG 0: 1
1: 1
2: 1
3: 12
4: 176
929998579_929998584 9 Left 929998579 2:46845807-46845829 CCCGGGGTAGGGAAATCCTGGGA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 929998584 2:46845839-46845861 CCCAGCATTCCTTTCCATCATGG 0: 1
1: 0
2: 5
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929998579 Original CRISPR TCCCAGGATTTCCCTACCCC GGG (reversed) Intronic
900138704 1:1129654-1129676 TCCCTGGATTTTCCCATCCCAGG - Intergenic
902365248 1:15968918-15968940 TACCAGGGGTTCCCAACCCCTGG + Intronic
903044613 1:20555302-20555324 TCCCAGGATGTCTGTACGCCTGG + Intergenic
903581212 1:24372460-24372482 TCTCAGGATCCCCCCACCCCGGG + Intronic
904842182 1:33379562-33379584 TCCCACTCTTTCCCTGCCCCTGG + Intronic
905068695 1:35206327-35206349 ACCCAGTATTTCCCTGCCTCTGG + Intergenic
907678124 1:56537543-56537565 TCCAAGGCCTTCACTACCCCAGG - Intronic
915367023 1:155322335-155322357 TGCCAGGACGTCCCTTCCCCAGG + Exonic
915375773 1:155393905-155393927 TCCCTGGATTTCCCAGCACCTGG - Intronic
920246067 1:204588658-204588680 GCCCAGGCTGTCTCTACCCCAGG - Intergenic
922578770 1:226681522-226681544 ACCCAGGATTTCCCTATGCCAGG + Intronic
1062906008 10:1180179-1180201 TCCCAGGATTCCCACAGCCCTGG - Exonic
1063032543 10:2250153-2250175 TCCCTGGCTTCCCCTAACCCAGG + Intergenic
1064093742 10:12407325-12407347 TTCCTGGAGTTCCCTTCCCCTGG - Intronic
1068616305 10:59121845-59121867 TCTCAGGATTTTCCTCCCCCTGG - Intergenic
1069749246 10:70735101-70735123 TCCCAGGCTTTCCCTTCCCAGGG - Intronic
1069783752 10:70974888-70974910 GCTCAGGCATTCCCTACCCCTGG - Intergenic
1070126523 10:73626353-73626375 TCCCAGCATTTTCCTTCTCCAGG + Intergenic
1070719642 10:78747164-78747186 CCCCAGCCTTTCCCCACCCCAGG + Intergenic
1071087894 10:81884729-81884751 TTCCAGGATTCCTCTCCCCCAGG - Intronic
1072030168 10:91511820-91511842 AACCAGGAGTTCCCAACCCCAGG - Intronic
1073146395 10:101284564-101284586 TCCGTGGATCTCCTTACCCCGGG - Intergenic
1073643377 10:105275380-105275402 CCCCAGGATGTCCCCAGCCCAGG - Intergenic
1073773951 10:106765615-106765637 TCCCATTCTTTCCCTCCCCCAGG - Intronic
1073863172 10:107770595-107770617 TCCCAGGATATACCTGCCCTGGG - Intergenic
1074123864 10:110512847-110512869 TCCCCGGCTCTCCCTACCCAAGG - Intergenic
1074124508 10:110517413-110517435 GACCAGGGTTTCCCAACCCCTGG + Intergenic
1074829311 10:117237657-117237679 TCTCAGCATTTCTCTGCCCCAGG - Intergenic
1075744436 10:124716848-124716870 TCCCATTCTTTCCCTTCCCCCGG - Intronic
1077305369 11:1866576-1866598 TCCCAGCCTCCCCCTACCCCTGG + Exonic
1077370132 11:2177900-2177922 TTCCAGCATCTCCATACCCCTGG + Intergenic
1077370277 11:2178428-2178450 TTCCAGCATCTCCATACCCCTGG - Intergenic
1077463138 11:2720927-2720949 TCCCAGGGTTTCCTCATCCCAGG + Intronic
1078509607 11:11975673-11975695 TCCCAGGATACCCCTAGCCCTGG - Intronic
1080110780 11:28565167-28565189 TCCCAGGATTTATCAATCCCTGG + Intergenic
1082016725 11:47494575-47494597 TCTCAAAATTTCCCCACCCCAGG + Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1088599460 11:111462162-111462184 TCCCAAGATTCCCCAGCCCCAGG + Intergenic
1088978015 11:114833080-114833102 TCCCGGGATTTCTCTACCCAGGG + Intergenic
1089422926 11:118345079-118345101 TCCCAGGATGTCCAGACTCCAGG - Intronic
1089981490 11:122776599-122776621 TTCCAGGGTATCCCTACCCAGGG + Intronic
1090828027 11:130401566-130401588 TCCCACACTTTCCCTGCCCCTGG - Intergenic
1091323050 11:134665142-134665164 TCCCCAGACTTCCCTAGCCCCGG - Intergenic
1092820296 12:12347496-12347518 TCACAGGGTTCCCCAACCCCTGG - Intronic
1094006074 12:25752929-25752951 TCCCAGGACATTCCTATCCCTGG - Intergenic
1094817460 12:34202525-34202547 TGCCAGAATTTCCTCACCCCTGG + Intergenic
1096578172 12:52567616-52567638 TCCCTGGCTTTCCCAACCCAAGG + Intronic
1097180135 12:57167080-57167102 TCTCAGGATGCCCCTCCCCCAGG - Intronic
1097613274 12:61852526-61852548 TCTCAGGATATTCCTACCCCTGG - Intronic
1098213710 12:68193629-68193651 TCCCTGGAGTACCCTTCCCCAGG - Intergenic
1103871960 12:124098717-124098739 TCCGAGAAATTCCCTATCCCTGG + Intronic
1103980853 12:124736201-124736223 GCCCAGGGTTTCCCTCTCCCTGG + Intergenic
1103994314 12:124819285-124819307 TCCCAGCGTCTCCCTACCACAGG - Intronic
1105494722 13:20920517-20920539 TCCCAGGCTTTTCCTGCACCTGG - Intergenic
1107824935 13:44320208-44320230 ACTCAGGCTTTCTCTACCCCCGG - Intergenic
1108922413 13:55692704-55692726 TGCCATGCCTTCCCTACCCCTGG + Intergenic
1109837056 13:67874154-67874176 CCCCAGGGTTTCCCTAACTCAGG + Intergenic
1110101038 13:71602844-71602866 TCCCTAGATTTCTCTCCCCCTGG - Intronic
1113308773 13:109108862-109108884 TCCCAGGATGTCCTCACCTCGGG - Intronic
1119260280 14:73234167-73234189 TCCCAGGATTCACCTCCTCCAGG - Intergenic
1120331236 14:83095056-83095078 TTCCAGGATTTTCCTCCTCCGGG + Intergenic
1121541113 14:94727390-94727412 TCCCAGCATTTCCAAGCCCCTGG - Intergenic
1124588248 15:31030669-31030691 ACCCAGTATCTCCCCACCCCAGG - Intronic
1124608572 15:31192099-31192121 TCCCACCCTTTCCCTAACCCTGG - Intergenic
1129385899 15:75195980-75196002 TCCCTGGAGATCCCTTCCCCCGG - Intronic
1129922035 15:79327470-79327492 TCCCAGAATTTTCCAACCCAGGG - Intronic
1131430408 15:92383647-92383669 CCCCAGGATTTACCTGCCACTGG + Intergenic
1132083202 15:98884895-98884917 TTCCAGGCTCTCCCTACCTCAGG + Intronic
1133155693 16:3873959-3873981 TCCCAGCACTTCCCTCCCCAGGG - Intronic
1134649880 16:15899936-15899958 TCCCCAGAATTCCCTAACCCTGG + Intergenic
1135114966 16:19716682-19716704 TCCCAGGTTTCCGTTACCCCTGG + Intronic
1138429413 16:56959138-56959160 TCCCAGGGATTCCCTTCCCCAGG + Intergenic
1139225278 16:65228491-65228513 TTCCAAGATTTCCCTACACCTGG - Intergenic
1139922604 16:70469345-70469367 TCCCATGGTCTCCCCACCCCAGG - Intronic
1142591108 17:1006500-1006522 GCCCAGCATCTCCCCACCCCTGG + Intronic
1145194330 17:20875439-20875461 ACCCAGGAATACCATACCCCAGG - Intronic
1145941714 17:28746221-28746243 TGCCAGGAATGCCCTGCCCCAGG + Intronic
1146492416 17:33292369-33292391 TCCCAGGCTTTCCCGGCCCCTGG + Exonic
1147362823 17:39942377-39942399 CCCCAGGGTGTCCCTATCCCAGG - Intronic
1147686591 17:42289672-42289694 TCCCAGGCTTCCCCTTTCCCAGG - Intronic
1148081525 17:44969669-44969691 TCCCTGGCCTTCCCTACCCAAGG + Intergenic
1148097330 17:45061455-45061477 TCCGAGGATTTCGTTACCCCCGG - Exonic
1151569057 17:74917158-74917180 TCGCAGGACTTACCCACCCCAGG + Exonic
1154100204 18:11465904-11465926 TCCCACAACTTCCCTACTCCAGG + Intergenic
1162036697 19:7943885-7943907 TCCCAGGAGTGCCCTCCCCCGGG - Exonic
1162756919 19:12866160-12866182 TCCCAGGCTTTACTTACCCCAGG - Intronic
1165742091 19:38210695-38210717 TCCCAGCCCTTCCCTTCCCCCGG + Intergenic
1166331093 19:42078379-42078401 TCCCAGGCAGTCCCTTCCCCAGG - Intronic
1166755068 19:45185591-45185613 CCCCAGGATTTTCCTGCCTCTGG - Intronic
1168495365 19:56843386-56843408 TCCCATGATTTCCCTTTCCATGG + Intergenic
925361439 2:3283205-3283227 TCTTAGGATGTCCCTGCCCCAGG - Intronic
926360173 2:12079501-12079523 TCCCCTGACTTCCCTACCCGCGG + Intergenic
928928095 2:36598248-36598270 TCCCAGGCTGTCCCAACCCTGGG + Intronic
929768460 2:44870661-44870683 TCCCAGGACTTCCTTATCCTTGG + Intergenic
929815764 2:45230117-45230139 TACCAGGGGTTCCCAACCCCTGG + Intergenic
929909175 2:46074517-46074539 TTCAAGGATTGACCTACCCCAGG + Intronic
929998579 2:46845807-46845829 TCCCAGGATTTCCCTACCCCGGG - Intronic
930399681 2:50867282-50867304 TCCCATGAATTCCCAACCACAGG - Intronic
930753297 2:54952572-54952594 TCCCATGATCTCTCTCCCCCAGG + Exonic
931446102 2:62328421-62328443 TCCCAGGAATTCCCTTCCCCAGG - Intergenic
932569181 2:72928954-72928976 TCCCAAGATCTCCCTGCCCTTGG - Intronic
939076559 2:137609493-137609515 TCCAAGCATTTCCTTGCCCCAGG - Intronic
940887451 2:159001904-159001926 ACCCAGCATTTCCCTATCCCAGG - Intronic
943046525 2:182867277-182867299 TCCCAGGCCTTCTCTTCCCCGGG - Intergenic
946026309 2:216673791-216673813 TCCCAGGATCTCCCCACCCTGGG + Exonic
946061444 2:216944978-216945000 CCCCAGGATTCCCATACCACAGG - Intergenic
946099690 2:217309285-217309307 TACCAGGAGTTCCCAACCACAGG - Intronic
1169073111 20:2745765-2745787 TGGAAGGATTTACCTACCCCGGG + Intronic
1170526902 20:17247847-17247869 TCCCTGGAGTTCCCTACTGCTGG + Intronic
1170641934 20:18162128-18162150 TCTCTGGATTTCTCTGCCCCTGG + Exonic
1171365146 20:24617998-24618020 TCTCAGCATCTCCCTTCCCCAGG - Intronic
1171426088 20:25049621-25049643 TCCCAGGGTTTGCCTTCCCAGGG - Intronic
1171562869 20:26143062-26143084 ACCCAGGAATACCATACCCCAGG - Intergenic
1171961312 20:31496966-31496988 TCCCAGCAGTTCCCTCCCCCTGG - Intergenic
1172583629 20:36066827-36066849 CCCCAGGAGTCCCCTGCCCCCGG - Intergenic
1175107284 20:56624671-56624693 CCCCAAGAATTCACTACCCCTGG + Intergenic
1175394480 20:58649568-58649590 TCCCCGAATTTCCCTCCCCAGGG + Intergenic
1175453826 20:59094746-59094768 TCCCAGCATTTCCCACCTCCAGG + Intergenic
1175852584 20:62101762-62101784 TCACAGGCTGTGCCTACCCCTGG + Intergenic
1175956710 20:62614370-62614392 TCCCAGGATACCCCTCCCACAGG - Intergenic
1176703806 21:10093605-10093627 TCCCTGGATTTCCTGGCCCCTGG + Intergenic
1179325166 21:40335082-40335104 ACCTAGGATGTCCCTTCCCCAGG + Intronic
1183207718 22:36431217-36431239 GCCCAGGACTTCCCAACTCCTGG + Intergenic
1184402552 22:44282293-44282315 GCCCAGGAGTTCCCTGCCCCTGG - Intronic
1184853344 22:47133440-47133462 TCCAAGGATTTGCCAGCCCCAGG + Intronic
950524161 3:13513817-13513839 TCTCAGGAGTTCCCATCCCCAGG - Intergenic
951049750 3:18081010-18081032 TCCCAGGATTACCCTAGCATAGG - Intronic
951557685 3:23937111-23937133 TGCCAGGATTACACCACCCCAGG - Intronic
952753090 3:36841415-36841437 CCCTAAGATTTCTCTACCCCAGG - Intronic
953247287 3:41205946-41205968 TCCCAGAAGTTTCCTACCTCTGG + Intronic
954798771 3:53175073-53175095 TCCATGGCTTCCCCTACCCCCGG - Intronic
957540931 3:81568023-81568045 CCCCAGCATTTTCCCACCCCTGG + Intronic
961439022 3:126940694-126940716 TCCCAGGACTTCCCAAGCACAGG + Intronic
961638382 3:128349278-128349300 TCCAAGGATTTCTCTAGCACAGG - Intronic
963662333 3:148142506-148142528 TTCCAGGATTTCCTTACTCAGGG - Intergenic
964749202 3:160039093-160039115 GCCCAGGCTGTCCCTACCCGCGG - Intergenic
967184090 3:186930672-186930694 GCCCAGGACTCCCCTCCCCCAGG - Exonic
968691372 4:1992069-1992091 CCCCAGGATTTCCCACCCGCAGG - Intronic
968948149 4:3676326-3676348 TCCCAGGCTTTCTTTACACCAGG + Intergenic
969463213 4:7339815-7339837 TCCCAGGACTTCCCAAACCCAGG - Intronic
970896615 4:21111162-21111184 TCCCAGCATTTCATTATCCCTGG + Intronic
971287843 4:25307645-25307667 TCCCAGGAGTTCCATGCCACGGG + Intergenic
973890642 4:55364289-55364311 TGCCAGGAGCTCCCCACCCCAGG + Intronic
975401551 4:73944471-73944493 TCCGAGAATTTCCCTGGCCCGGG - Intergenic
975578128 4:75883363-75883385 TCCCATAATTTCTCTACCCAGGG - Intronic
977330444 4:95630622-95630644 TCCCAGCAGGTCCATACCCCAGG + Intergenic
980376022 4:131949956-131949978 TCCCTGGATTTCCTGGCCCCTGG + Intergenic
981819697 4:148871717-148871739 TCCCAATTTTTCCCTTCCCCTGG - Intergenic
982340699 4:154295102-154295124 ACCAAGGATTTCCTTTCCCCAGG - Intronic
983700145 4:170581682-170581704 TACCAGGAGTCCCCAACCCCTGG - Intergenic
985510885 5:313124-313146 TCCCAGGCTGTCCCCACCCTTGG + Intronic
985748664 5:1661991-1662013 TCCAAGGCATCCCCTACCCCTGG - Intergenic
986634068 5:9802346-9802368 TCCCAGGAAGTCCCAACCCTAGG + Intergenic
988544860 5:32146078-32146100 GCCCAGGAATTCCAGACCCCTGG + Intronic
990067005 5:51728906-51728928 TCCCTGGATATACCTACCCTAGG + Intergenic
990395189 5:55370527-55370549 TCCCTGCATTTCTCTACCTCTGG + Intronic
991010317 5:61875815-61875837 TCCCAGAATCTCACTATCCCTGG + Intergenic
991178415 5:63719102-63719124 TCTCAAGATTTCCCACCCCCTGG + Intergenic
992205015 5:74422850-74422872 TCCCATGAGTTTCCTACCCGGGG - Intergenic
992790349 5:80208080-80208102 TGCCAGGGTTTCGTTACCCCTGG + Intronic
993385841 5:87262199-87262221 TACCAGGATTTCAGAACCCCTGG - Intergenic
995737408 5:115316423-115316445 TCCCAAGACTACCCTACCCGTGG - Intergenic
997977406 5:138448433-138448455 TGCCAGCCTTTCCCTCCCCCTGG - Intergenic
999391928 5:151199523-151199545 TCCCAACATTTCTCTTCCCCAGG + Intronic
1000007725 5:157202977-157202999 ACCCAGTATTTTTCTACCCCAGG + Intronic
1000926864 5:167204632-167204654 TCATAAGATTTCCCTGCCCCTGG - Intergenic
1001702395 5:173716565-173716587 TCCCTGGATTTTCCTTCCCCAGG + Intergenic
1003076441 6:2987473-2987495 CACCAGGAGTTCCCAACCCCCGG - Intergenic
1003646662 6:7918172-7918194 TCCCAGGAATTCTCAACCCTAGG - Intronic
1004177285 6:13350801-13350823 ACCCAGGATTTTCCTCTCCCCGG - Intergenic
1005898487 6:30197611-30197633 TTCCAGGATCTCCCTCCCCAAGG + Intronic
1006095218 6:31652102-31652124 TCCCAGGATTTTCCGACCTCTGG - Intronic
1006214569 6:32429220-32429242 GCCCAGGGGTTCCCAACCCCTGG - Intergenic
1007072578 6:39048298-39048320 TCCCAGGATTACCCCTTCCCAGG - Intergenic
1007222379 6:40289107-40289129 TCCCAGGTTTTTCTTTCCCCTGG + Intergenic
1012931412 6:105321380-105321402 TCCCAGAATTTCCCTGTACCTGG - Intronic
1014781932 6:125574630-125574652 TCCCAGGACTGCCCTGCCTCTGG - Intergenic
1016139948 6:140595676-140595698 TCCCAGTCTTTCCCTCTCCCAGG - Intergenic
1017635295 6:156437207-156437229 TCGCAGGCTGTCTCTACCCCAGG - Intergenic
1018968434 6:168507571-168507593 TCCCAGGAGCTGCCTGCCCCCGG + Intronic
1019257088 7:59407-59429 CCCCAGGAATTAGCTACCCCTGG + Intergenic
1019280607 7:197985-198007 TGCCAGGGAATCCCTACCCCAGG + Intronic
1019478414 7:1255135-1255157 TCCTAGGATCTCCCTATCCTGGG + Intergenic
1020721594 7:11751793-11751815 ACCCAGGATAACCCAACCCCTGG + Intronic
1022329147 7:29361051-29361073 TGCCAGGAATTCCCAGCCCCGGG - Intronic
1023922427 7:44639848-44639870 TCCCAGCATTTTCCTTCCCGGGG + Intronic
1031942606 7:127805164-127805186 AACCAGGATTCCCCTAACCCAGG + Intronic
1032712394 7:134471703-134471725 TCCCAGAATGTCCCAACCACTGG + Intergenic
1035045837 7:155964751-155964773 CCCCAGGGTTTCCCCAGCCCTGG - Exonic
1035937814 8:3861909-3861931 TTCCAGGATTTCCTTGCTCCTGG + Intronic
1036753370 8:11456879-11456901 TCCCCCCATTTCCCTAACCCAGG - Intronic
1038085597 8:24193096-24193118 ACTCAGGGTTTCCCAACCCCTGG + Intergenic
1039033441 8:33333575-33333597 TCTCAGGAATACTCTACCCCTGG - Intergenic
1041455128 8:58050840-58050862 GGCCAGGATTTCCCACCCCCTGG - Intronic
1041635259 8:60135829-60135851 TCCTAGGATTTCCCTATCTAAGG + Intergenic
1050113806 9:2242557-2242579 TCCCAGGTTTTGCCTTCGCCCGG - Intergenic
1051208852 9:14720103-14720125 TCCCAGGATTCCTTTATCCCAGG - Exonic
1053196634 9:36124942-36124964 TCCCATGGTCTCCCTGCCCCAGG - Intergenic
1054321811 9:63676920-63676942 TCCCTGGATTTCCTGGCCCCTGG + Intergenic
1058705733 9:107636862-107636884 TCTCAGGTTTGCCCTAGCCCTGG - Intergenic
1059079365 9:111232309-111232331 GACCAGGAGTTCCCCACCCCTGG + Intergenic
1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG + Intergenic
1061732846 9:132629849-132629871 TCACACAATTTCCCTCCCCCAGG - Intronic
1061857887 9:133452935-133452957 GCCCTGGATATCCCTCCCCCAGG + Intronic
1062219817 9:135409202-135409224 CCCCAGGATCTGCCCACCCCAGG + Intergenic
1202788843 9_KI270719v1_random:63700-63722 TCCCTGGATTTCCTGGCCCCTGG + Intergenic
1186671124 X:11768267-11768289 TCTCTGGATTTGCCTACCCTGGG + Intronic
1189318554 X:40073381-40073403 CCCCACCAATTCCCTACCCCAGG - Exonic
1190786071 X:53650327-53650349 TCCCAATATTTCCCAAACCCTGG + Intronic
1196893082 X:120309121-120309143 TCCCCGGAGTTCCCTGGCCCTGG - Intronic
1200922217 Y:8623345-8623367 TCCCAGGGTTGCCCTATCTCAGG + Intergenic