ID: 930002101

View in Genome Browser
Species Human (GRCh38)
Location 2:46868546-46868568
Sequence CCTTCCTAGCGCTCTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930002096_930002101 -7 Left 930002096 2:46868530-46868552 CCCTGACCACACGCCTCCTTCCT No data
Right 930002101 2:46868546-46868568 CCTTCCTAGCGCTCTCCTGATGG No data
930002097_930002101 -8 Left 930002097 2:46868531-46868553 CCTGACCACACGCCTCCTTCCTA No data
Right 930002101 2:46868546-46868568 CCTTCCTAGCGCTCTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930002101 Original CRISPR CCTTCCTAGCGCTCTCCTGA TGG Intergenic
No off target data available for this crispr