ID: 930002956

View in Genome Browser
Species Human (GRCh38)
Location 2:46873598-46873620
Sequence TTCACCAGATCTGTGCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930002956_930002967 30 Left 930002956 2:46873598-46873620 CCCCATTGCACAGATCTGGTGAA No data
Right 930002967 2:46873651-46873673 TGAATGAGCTCTCTCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930002956 Original CRISPR TTCACCAGATCTGTGCAATG GGG (reversed) Intergenic
No off target data available for this crispr