ID: 930003176

View in Genome Browser
Species Human (GRCh38)
Location 2:46874958-46874980
Sequence CTGGATAAACTGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930003167_930003176 3 Left 930003167 2:46874932-46874954 CCTTCACATGCTTTCCCGACCCT No data
Right 930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930003176 Original CRISPR CTGGATAAACTGAGGCAGGA AGG Intergenic
No off target data available for this crispr