ID: 930011414

View in Genome Browser
Species Human (GRCh38)
Location 2:46941023-46941045
Sequence GAGCTCCGACTCCGCGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930011404_930011414 10 Left 930011404 2:46940990-46941012 CCCGGGCGCCGGGGCTCCGCGCG 0: 1
1: 0
2: 1
3: 36
4: 314
Right 930011414 2:46941023-46941045 GAGCTCCGACTCCGCGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 78
930011409_930011414 -6 Left 930011409 2:46941006-46941028 CCGCGCGGGATTAAAGTGAGCTC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 930011414 2:46941023-46941045 GAGCTCCGACTCCGCGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 78
930011403_930011414 11 Left 930011403 2:46940989-46941011 CCCCGGGCGCCGGGGCTCCGCGC 0: 1
1: 0
2: 3
3: 40
4: 303
Right 930011414 2:46941023-46941045 GAGCTCCGACTCCGCGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 78
930011408_930011414 2 Left 930011408 2:46940998-46941020 CCGGGGCTCCGCGCGGGATTAAA 0: 1
1: 0
2: 0
3: 2
4: 22
Right 930011414 2:46941023-46941045 GAGCTCCGACTCCGCGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 78
930011405_930011414 9 Left 930011405 2:46940991-46941013 CCGGGCGCCGGGGCTCCGCGCGG 0: 1
1: 0
2: 3
3: 42
4: 324
Right 930011414 2:46941023-46941045 GAGCTCCGACTCCGCGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 78
930011402_930011414 12 Left 930011402 2:46940988-46941010 CCCCCGGGCGCCGGGGCTCCGCG 0: 1
1: 0
2: 0
3: 43
4: 286
Right 930011414 2:46941023-46941045 GAGCTCCGACTCCGCGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930011414 Original CRISPR GAGCTCCGACTCCGCGGCGG GGG Intronic
903830095 1:26169585-26169607 GACCTTGGACTCCGCGGTGGGGG - Intergenic
904690820 1:32292221-32292243 GAGCACCGTCCTCGCGGCGGGGG + Intronic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
914808369 1:151008401-151008423 GAGCCCCGCCTCCGCCGCTGGGG + Intronic
916910169 1:169337518-169337540 GAGCTCCCACAGCGCAGCGGTGG + Intronic
922239970 1:223749043-223749065 GGCCTCCGAGTCCGCGGCGCTGG - Exonic
1072190525 10:93073609-93073631 GAGCTCCGAGGCGGCGGTGGGGG - Intronic
1074182581 10:111077299-111077321 GAGCTCCGGGACGGCGGCGGCGG - Exonic
1081805008 11:45885710-45885732 TAGCCCGAACTCCGCGGCGGCGG + Exonic
1083902999 11:65652698-65652720 GGGCTCCGGCTCCGGGGGGGCGG - Intergenic
1089200593 11:116722557-116722579 GAGCTCCCACTCTGCTGCTGTGG - Intergenic
1090296383 11:125592117-125592139 GGGCTGTGCCTCCGCGGCGGTGG + Intronic
1090327895 11:125904604-125904626 GAGCTCCACCCCCGCGGCTGTGG - Intronic
1092502653 12:9064547-9064569 CCACTCCCACTCCGCGGCGGCGG - Intergenic
1095261756 12:40106000-40106022 GGGCTCCAACTCCGCAGCGTCGG - Intronic
1097891384 12:64780854-64780876 GAGCTGGAATTCCGCGGCGGCGG + Intergenic
1102853963 12:116277525-116277547 GAGTTCGCGCTCCGCGGCGGCGG - Intergenic
1104420071 12:128627785-128627807 GAGGCCTGACTCCTCGGCGGAGG - Intronic
1107604027 13:42040809-42040831 GAGCCCCGGCGCAGCGGCGGCGG + Intronic
1120834442 14:89027387-89027409 GCTCTCCGGCTCCGCGGCGCGGG + Intergenic
1122917486 14:104865668-104865690 CAGGGCCGCCTCCGCGGCGGCGG - Intronic
1123739909 15:23226293-23226315 GCGCTACGAGTCCGCCGCGGTGG - Intergenic
1124291132 15:28455261-28455283 GCGCTACGAGTCCGCCGCGGTGG - Intergenic
1127512571 15:59657330-59657352 GCACTCCGACTCCGGGGGGGCGG + Intronic
1128743347 15:70097633-70097655 GCGCTCCGACGCGGCAGCGGCGG - Exonic
1132729765 16:1355687-1355709 GAGCTCTGCCTCGGTGGCGGTGG + Intronic
1136107872 16:28043680-28043702 GAGCTCCCACTCAGTGCCGGAGG + Intronic
1139952775 16:70680131-70680153 GGGCTCCGCCTGCGCGGCCGGGG - Intronic
1140049520 16:71467946-71467968 TAGCTCCGACTCAGTGGGGGGGG + Intronic
1142910859 17:3089682-3089704 GAGCTCCGACTCTCCTTCGGTGG + Intergenic
1144586851 17:16492256-16492278 GAGCTCCGGCGCGGAGGCGGGGG - Intergenic
1144682767 17:17206317-17206339 GCGCGCAGACTCCGCTGCGGCGG - Intronic
1146398587 17:32487087-32487109 GAGCGCCGGGACCGCGGCGGCGG + Exonic
1147184290 17:38705295-38705317 GGGCTCGGGCTACGCGGCGGCGG + Intergenic
1148852465 17:50561585-50561607 CAGCGCGGACTCCGAGGCGGAGG + Exonic
1150002914 17:61452474-61452496 GGGCTCCGACTCCGCGCCGCTGG - Intronic
1152687683 17:81702677-81702699 GCGCTCCGAGTCTGCGGCCGGGG + Intronic
1152761430 17:82109237-82109259 GAGCTCAGACTCCAGGGCTGGGG + Intronic
1162683771 19:12365364-12365386 CAGCTCCCACCCCGCGGCCGAGG + Intronic
1163666633 19:18606685-18606707 GGGCTGCGGCTCGGCGGCGGTGG + Exonic
1166543286 19:43619573-43619595 CCGCTCCGGCTCTGCGGCGGCGG + Exonic
927542745 2:23927217-23927239 GAGCGCTGACGCCGCGCCGGGGG - Intergenic
930011414 2:46941023-46941045 GAGCTCCGACTCCGCGGCGGGGG + Intronic
932231345 2:70086885-70086907 CAGCTCCTGCTCCCCGGCGGCGG - Intergenic
932314070 2:70768060-70768082 GTGCAGCGGCTCCGCGGCGGCGG + Exonic
946422247 2:219571404-219571426 GAGCTGCAGCTCTGCGGCGGCGG + Intronic
948387934 2:237593227-237593249 GAGCCCCGACTCCGGGCCGCAGG - Intronic
1168756779 20:324188-324210 GAGGTGCGGCTCCGCGGCGCGGG - Intergenic
1172596565 20:36154619-36154641 GGGCTCCGAGGCCGGGGCGGGGG + Intronic
1178457635 21:32771093-32771115 GAGCTCCGGCCCCGTGGCAGAGG + Intronic
1179411981 21:41168819-41168841 GAGCTCCCCCTCCGCGGGGCTGG + Intronic
1181085158 22:20436480-20436502 GAGCCCCGCCTCCGGGGCGGGGG - Intronic
1185381210 22:50508139-50508161 GAGCTCCCGCTGCGCGGCGCCGG + Intergenic
950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG + Intronic
954063582 3:48088773-48088795 CAGCTCCGTCTCGGCGGCGGCGG - Exonic
955368694 3:58332812-58332834 GCGCTAGGACTCCGGGGCGGCGG + Intergenic
961551103 3:127671159-127671181 GAGCTCAGACTCAGCGGCTGGGG + Intronic
966201081 3:177359913-177359935 GAGCTCCGGCTCTGCCGCCGCGG - Intergenic
966743565 3:183254573-183254595 GAGCTCCGGCTCCTCGGTGGCGG + Intronic
969393987 4:6909296-6909318 GAGCTCAGGCCCCGCCGCGGTGG - Intronic
972960726 4:44448732-44448754 GAGCTCCGCCGGTGCGGCGGCGG + Exonic
975118543 4:70705085-70705107 GGGCTCCGACTGCCCGGCGGGGG - Intronic
984462965 4:180059064-180059086 GAGTGCCGAGGCCGCGGCGGAGG + Intergenic
989643192 5:43603161-43603183 CAGCCCCAACTCCGCGGCGGCGG - Intronic
991371619 5:65925722-65925744 GCGCCGCGACTCTGCGGCGGGGG - Intergenic
992444085 5:76819124-76819146 GAGTTTCGAATCGGCGGCGGCGG + Exonic
997129784 5:131264610-131264632 GAGCTCCGACTCTTCGCCTGAGG + Intronic
1000014691 5:157266436-157266458 GAGCTCCGGCGCGGCGGCGGGGG + Intronic
1002185861 5:177454606-177454628 GCGCCCGGGCTCCGCGGCGGCGG + Intronic
1002688244 5:181032352-181032374 CAGAGCCGACTCCGAGGCGGAGG - Intergenic
1003139026 6:3456346-3456368 GAGCTGCTGCTCCGCGGCTGCGG - Exonic
1007431525 6:41779914-41779936 GACCTCCGACCCCGCGGCCGCGG - Intronic
1007558107 6:42783144-42783166 CCGCTCCGAGCCCGCGGCGGCGG + Intronic
1008370098 6:50722163-50722185 GAGCTGCGCCTCCGAGGCAGTGG - Intronic
1008649023 6:53544798-53544820 CCGCTCCGGCTCCCCGGCGGCGG + Exonic
1013048824 6:106512406-106512428 GAGCTCGGCGTCCGCGCCGGGGG - Exonic
1016590111 6:145735155-145735177 GAGCTCCCGCTCTGCGCCGGGGG + Intronic
1017731882 6:157324051-157324073 GAGCACTCACACCGCGGCGGAGG - Intergenic
1019421803 7:954278-954300 GAGCGCGGACGCCGCGGGGGTGG - Intronic
1019475263 7:1241345-1241367 CCGCTGCGACTCCGGGGCGGGGG + Intergenic
1023637586 7:42228065-42228087 GAGGTCCCAGGCCGCGGCGGCGG + Intronic
1028373430 7:90119629-90119651 TACCTCCGGCTCCGGGGCGGAGG - Intergenic
1032011652 7:128351478-128351500 GACCTCCTACTCCAGGGCGGAGG - Exonic
1037769163 8:21788988-21789010 GAGCGCCGAGCCCGGGGCGGAGG - Intronic
1052466903 9:28840171-28840193 CAGCTGTGACTCCGCGGCTGTGG + Intergenic
1196965225 X:121047797-121047819 GAGCCCCGGCTGCGAGGCGGCGG - Exonic
1198386568 X:136134722-136134744 GGGCTCCGACCCCACGGCAGTGG + Intergenic
1200235073 X:154464201-154464223 GAGCTGCGCCTTCGAGGCGGCGG + Exonic