ID: 930011450

View in Genome Browser
Species Human (GRCh38)
Location 2:46941145-46941167
Sequence TCCCCACGCCCCCGCGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930011442_930011450 -6 Left 930011442 2:46941128-46941150 CCCGGCTCGCCGAGGCCTCCCCA 0: 1
1: 0
2: 1
3: 19
4: 264
Right 930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 203
930011438_930011450 14 Left 930011438 2:46941108-46941130 CCGCGCTGGCAGCCAGCGAGCCC 0: 1
1: 0
2: 1
3: 20
4: 188
Right 930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 203
930011443_930011450 -7 Left 930011443 2:46941129-46941151 CCGGCTCGCCGAGGCCTCCCCAC 0: 1
1: 0
2: 0
3: 29
4: 260
Right 930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 203
930011436_930011450 28 Left 930011436 2:46941094-46941116 CCTGGCTGCTGTGGCCGCGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
Right 930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 203
930011440_930011450 2 Left 930011440 2:46941120-46941142 CCAGCGAGCCCGGCTCGCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 108
Right 930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930011450 Original CRISPR TCCCCACGCCCCCGCGGGGG TGG Intronic
900117266 1:1034003-1034025 TCCCCTCGTCCCCGCGGGGCTGG - Intronic
901050698 1:6424663-6424685 TCCCCGCGTCGCGGCGGGGGCGG + Intronic
901676471 1:10888740-10888762 GCCCCACCCCCCGGCGCGGGAGG + Intergenic
901797938 1:11691490-11691512 GCCCCGCGCCCTCGCGGCGGCGG + Exonic
903193414 1:21668948-21668970 TCCCCACCCACCCAGGGGGGTGG + Intronic
903438379 1:23369164-23369186 TAGCCAGGCCCCTGCGGGGGGGG + Intronic
906355976 1:45106266-45106288 TCCCCACCTCCCAGAGGGGGCGG - Intronic
907411754 1:54288179-54288201 TCCCCAGGCCCAGGCGGTGGTGG - Intronic
908131837 1:61082368-61082390 CCCCCTCCCCCCCGCGGCGGCGG + Intronic
912619488 1:111140466-111140488 TCCCCACAACCCCGCGCGCGAGG - Intronic
915616867 1:157045865-157045887 TTCCCTCGCTCCCGCGGGGCGGG + Intergenic
918480726 1:184974273-184974295 TCCCCAGGCCCCCGGGCGGGCGG + Intronic
918487666 1:185045990-185046012 TCCCCTCGCCTCCGGGGGCGGGG + Intronic
918781696 1:188708098-188708120 TCCCAACTCCCCTGCTGGGGAGG + Intergenic
919785450 1:201255269-201255291 TCCCCAGGGTCCCGCAGGGGCGG - Intergenic
922505043 1:226121543-226121565 ACCCCCGGCCCCTGCGGGGGGGG - Intergenic
922648627 1:227318138-227318160 TCCCGACGCCCCAGGCGGGGGGG + Exonic
922703323 1:227775043-227775065 TCAGGACGCCCCCGCGGCGGTGG - Intronic
1063449936 10:6144704-6144726 TCCCCCCGGTCCCGCAGGGGCGG - Intergenic
1072480985 10:95809698-95809720 TCCCCACCCCCCAGACGGGGTGG + Intronic
1075892933 10:125970215-125970237 CCCCCACCCCCCAGAGGGGGCGG + Intronic
1077038003 11:504475-504497 TCCGCCCGCCCCCGCCTGGGCGG - Intronic
1077134909 11:993681-993703 GCAGCACGCCCCCGCGGGGGGGG - Intronic
1080012319 11:27471995-27472017 TCCCCAGGCCCGGGCGGCGGCGG + Intronic
1081636885 11:44727328-44727350 TCCCCAGGTCCCCGGGGGCGCGG - Intronic
1083780023 11:64913010-64913032 TCCCCAGGCCCCTGGGGAGGGGG - Intronic
1083798463 11:65032344-65032366 TCCTCACGCCCCCTGGGGGCAGG + Intronic
1083879355 11:65540456-65540478 TCCCCACGGCCGCCGGGGGGCGG + Intronic
1084546226 11:69816449-69816471 TCCCGCCGCCCCCACGGAGGGGG + Intronic
1092265283 12:6976267-6976289 TCTCCACCCCCCCATGGGGGGGG + Exonic
1097254805 12:57665271-57665293 TCCCCACCTCCCAGAGGGGGTGG - Intergenic
1101740354 12:107495383-107495405 CCCCCAAGCCCCAGCGGGGATGG + Intronic
1102707412 12:114894231-114894253 TCCCTACACCCCTGCGAGGGAGG - Intergenic
1103919391 12:124391488-124391510 ACCCCAAGCCCTGGCGGGGGGGG + Intronic
1104849240 12:131863369-131863391 TACCCACGAGCCTGCGGGGGCGG + Intergenic
1105850316 13:24328400-24328422 ACCACACGCACCCGCGCGGGGGG + Intergenic
1105945723 13:25187843-25187865 TCCCCACTTCCCCGCAGGGCAGG - Intergenic
1112507194 13:99982127-99982149 TCACCACTCCGCCGCGGCGGCGG + Exonic
1118350768 14:64971599-64971621 TCCCCACACCCCCAGGGGGAGGG - Intronic
1118992540 14:70809412-70809434 CCCGCTCGCCCCCCCGGGGGCGG + Exonic
1121690705 14:95875959-95875981 TCGCCACGCTCCCGCCGGGGCGG + Intergenic
1122130950 14:99604306-99604328 TCCCCAGTCGCCCTCGGGGGCGG - Intergenic
1122738180 14:103855633-103855655 TCCCCACCCCCACACTGGGGAGG - Intergenic
1122775919 14:104116942-104116964 TCCGCGCGCCCGCGCGGGGGTGG - Intergenic
1122898061 14:104770157-104770179 TCCCTACCCCGCTGCGGGGGAGG + Exonic
1202839385 14_GL000009v2_random:107268-107290 TCCCCAGGCCCCAGCAGTGGTGG + Intergenic
1202908760 14_GL000194v1_random:97421-97443 TCCCCAGGCCCCAGCAGTGGTGG + Intergenic
1124439269 15:29674999-29675021 CGCCCAGGCCCCGGCGGGGGAGG - Intergenic
1125300993 15:38252986-38253008 CCGCCACCCCCCTGCGGGGGTGG + Exonic
1125594233 15:40874063-40874085 GCGCTACGCCGCCGCGGGGGAGG + Exonic
1126480218 15:49110778-49110800 TCCCCAGGCCCCTGTGGGGATGG - Intronic
1127103295 15:55588434-55588456 TCCCCAGCCCCGCGCGGGGACGG + Intronic
1128146691 15:65335912-65335934 TCCCCAGGCCACCGTGGGTGAGG - Exonic
1128489852 15:68134895-68134917 TCCCCACCTCCCAGCAGGGGTGG + Intronic
1128490089 15:68135419-68135441 TCCCCACCTCCCAGCAGGGGTGG + Intronic
1129675911 15:77632445-77632467 TCCGCGCGCCCTCGCGGGGCTGG + Exonic
1129688977 15:77702436-77702458 TCCCCAGGCCCCTGGGGTGGAGG - Intronic
1130923211 15:88366213-88366235 TCCCCACAGCCCCGTGAGGGAGG + Intergenic
1132398140 15:101489260-101489282 TTCCCACGCGCGCGCGGGGCCGG + Intronic
1132783507 16:1641815-1641837 TCCCCACGCCACAGCCTGGGGGG + Intronic
1133018348 16:2955145-2955167 CCCCCACCCCCCCGCAGGGGTGG - Intergenic
1133411569 16:5573279-5573301 TCCCCACGGCCTCGGGTGGGAGG + Intergenic
1134410558 16:14000274-14000296 TTCCCAGCCCCCGGCGGGGGAGG + Intergenic
1135207040 16:20492627-20492649 TTCCCAGGCCCCCGAGGGTGCGG - Intergenic
1135211845 16:20531005-20531027 TTCCCAGGCCCCCGAGGGTGCGG + Intergenic
1135479827 16:22813715-22813737 TCCCCACCCCCGCGTGGGTGTGG + Intergenic
1135479832 16:22813718-22813740 CCCCCACACCCACGCGGGGGTGG - Intergenic
1136258941 16:29060641-29060663 TCCCCACTTCCCCGACGGGGTGG + Intergenic
1136381973 16:29900104-29900126 TCCCCTCGCCCCGCCGGGGCGGG + Intergenic
1137618154 16:49858724-49858746 CCCCCACGCCCCCGCGGCCCAGG + Intergenic
1139410012 16:66751531-66751553 TCCCAACGGGCCCGCGGTGGCGG - Exonic
1142367519 16:89657853-89657875 TCCCCACACCTCCGCGGCCGCGG - Exonic
1142376873 16:89711139-89711161 GCCCCCCGCCCCCGCTGGGGAGG + Intronic
1142492119 17:286035-286057 TCCCCCCGCCACTGCTGGGGGGG + Intronic
1142757572 17:2025008-2025030 TCACCATGCCCCTGCGGGGCCGG - Exonic
1145815738 17:27793772-27793794 TCGCCCCGCCCCCGGGGCGGGGG - Intronic
1146280217 17:31539882-31539904 TCCCCACGCTCCTGGGGGAGGGG + Intergenic
1147017873 17:37506929-37506951 TCCACACCCCCCCGCGTGTGTGG + Intronic
1147670583 17:42174668-42174690 TCCCCAGGCCCCCTTGGGTGTGG - Intronic
1148786601 17:50148987-50149009 CCCCCACGCCCCCCTGAGGGTGG + Intronic
1148806297 17:50265644-50265666 TCCCCAAGGCCCCCCAGGGGAGG + Intergenic
1149614826 17:57988471-57988493 ACCACACACCCCCGCGGGGGGGG - Intergenic
1152131073 17:78476817-78476839 TCCCCTCGCCCCGGGGGAGGGGG - Intronic
1152361197 17:79833911-79833933 TCCCCGCCCCCCCGCGGGAATGG + Exonic
1152408791 17:80111821-80111843 TCCCCACGCCTCTGTGGGGCTGG - Intergenic
1152655853 17:81518979-81519001 TCCCCAGCGCGCCGCGGGGGCGG + Intronic
1155654276 18:28176874-28176896 TCCCCGCGCCGCTGCGGGGCCGG - Intronic
1156331700 18:36129461-36129483 GCGCCACGCCCCCGCGGCGTCGG - Intronic
1160714021 19:567113-567135 TCCCCCCGCCCCCCCGTGGTTGG - Intergenic
1160822589 19:1065431-1065453 TCCCCGCGGCCCCGCAGGGGAGG - Exonic
1161059386 19:2207487-2207509 TCCCCACGCCTGCCCTGGGGTGG + Intronic
1161087861 19:2343457-2343479 TCCCAAAGCCCCCGCTGAGGCGG + Intronic
1161152692 19:2717928-2717950 GCCCCACGCCCCGGGGAGGGAGG + Intronic
1161163104 19:2771566-2771588 TCCCCCCCCCCCCGATGGGGAGG - Intronic
1161589820 19:5124284-5124306 TCCCCAGGCCGGCGCGGTGGGGG + Intronic
1162128227 19:8510845-8510867 CCCCGACGCCCCCGCGGGTAAGG - Exonic
1163158204 19:15450068-15450090 CCCCCTCGCCGCCCCGGGGGGGG + Intergenic
1163635068 19:18433837-18433859 GCCCGACGCCGCCGCGGGGGGGG - Intronic
1163765426 19:19160891-19160913 TCCCTAGGCCCCCGGGGAGGAGG - Intronic
1164679465 19:30124083-30124105 TCCCCACACCCCCGCTGGAGGGG - Intergenic
1165768238 19:38364018-38364040 TCCCCACTTCCCAGCAGGGGCGG + Intronic
1166985821 19:46659651-46659673 TCCCCACTCCCCATCTGGGGAGG + Intronic
1167292241 19:48630655-48630677 TCCCCCCTCCCTTGCGGGGGCGG - Exonic
1167609703 19:50501247-50501269 TCCCCACGCCTCTGCTGGTGTGG - Intergenic
1167619021 19:50551159-50551181 TCCCCACAACCCCACGGTGGGGG + Intronic
1167913224 19:52720763-52720785 TCCCCACTTCCCCGATGGGGTGG + Intronic
927168581 2:20350322-20350344 GCCCCACGCCCCCGAGGCGGCGG + Intronic
930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG + Intronic
931256914 2:60581897-60581919 CCTCCACCGCCCCGCGGGGGAGG + Intergenic
932594276 2:73084444-73084466 TCCCCACCCCCAAGCGGTGGGGG + Intronic
932702793 2:74002667-74002689 TCCCCTCCCCGCCGCGGGGCTGG - Intronic
932812299 2:74835131-74835153 TCCCCGCGGCCCTGCGGGGGTGG + Intronic
934655848 2:96116554-96116576 TCCCCACTCCCCTGCAGGCGCGG - Intergenic
934754623 2:96816549-96816571 GCGCCACTCGCCCGCGGGGGAGG - Exonic
935622729 2:105143844-105143866 TCACCCCGCCCCCCGGGGGGCGG + Intergenic
937082587 2:119151082-119151104 TCCCCAAGGCCCCAAGGGGGAGG + Intergenic
937302075 2:120848704-120848726 TCCCCACACCCCAGTGTGGGTGG - Intronic
938828952 2:135033626-135033648 TCCCCACCTCCCAGCAGGGGTGG + Intronic
940353678 2:152717312-152717334 TCCCCAGGACCCTGCGAGGGAGG + Intronic
941602981 2:167563589-167563611 TCCCCACTTCCCAGCAGGGGCGG + Intergenic
941603078 2:167563831-167563853 TCCCCACCTCCCAGCAGGGGCGG + Intergenic
944237419 2:197453148-197453170 TCCCGCAGCCCCCGGGGGGGTGG + Intergenic
945115202 2:206401613-206401635 TCCTCACGTCCCAGAGGGGGCGG + Intergenic
946422804 2:219574552-219574574 TCCCCACGTCCCGGAGGGCGTGG + Intronic
947669139 2:231925783-231925805 GCCCCACGCGCCCGCCGGCGCGG + Intronic
948422719 2:237870362-237870384 TCTCCAGGCCTCCGTGGGGGCGG + Intronic
948479331 2:238240228-238240250 TCCCTAGACCCCCGCGGGGGCGG + Intronic
1168814575 20:728122-728144 TCAGCTCGGCCCCGCGGGGGCGG + Intergenic
1172338115 20:34133110-34133132 TCCCCACCTCCCAGCAGGGGCGG - Intergenic
1175760671 20:61560624-61560646 TCGCCAGGGCCCCGCGGGTGGGG - Intronic
1176024298 20:62978026-62978048 TCCCCACCACCCTGCTGGGGCGG + Intergenic
1176126933 20:63479774-63479796 TCCCCACCCTCCCGTGGGGTGGG - Intergenic
1177577804 21:22981831-22981853 TCCCCACGCCCCGGCAGTGGTGG + Intergenic
1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG + Exonic
1184649603 22:45913508-45913530 TCTCCAGGCCCCCCCAGGGGTGG - Intergenic
1184652921 22:45927299-45927321 TCCCCAAGCTCCCTGGGGGGCGG - Intronic
952942685 3:38455501-38455523 TCCCCACGCTGCTGCGGGGGTGG + Intronic
954784181 3:53081068-53081090 TCCCCATGCCCCAGCCAGGGAGG - Intronic
959054101 3:101551574-101551596 TCCCCACGTCCCAGATGGGGCGG - Intergenic
959963933 3:112333046-112333068 TCCCCACGCCCTCACAGGAGCGG - Intronic
960938068 3:122915485-122915507 TCCCCTCGACCCCGCTGTGGGGG - Exonic
961083474 3:124045850-124045872 TCCCCACGCCCATCCGGGTGAGG - Intergenic
963067781 3:141277623-141277645 TCCCCACCCCCTGGCAGGGGTGG - Intronic
968583756 4:1406516-1406538 TCCACACGACCCCGCGCAGGCGG + Intergenic
968609275 4:1549756-1549778 CCCACACGCCCCCGAGGGGCTGG + Intergenic
968651771 4:1763031-1763053 TCCCCACGCCCCCTCGGGTGGGG + Intergenic
968658224 4:1787709-1787731 TCCCCACACCCCGGCTGGGCTGG + Intergenic
968667009 4:1827971-1827993 TCCCCACTTCCCAGCAGGGGCGG + Intronic
968667354 4:1828735-1828757 TCCCCACTTCCCAGCAGGGGCGG + Intronic
969114945 4:4865659-4865681 TCGACAAGCCCCCGCGCGGGAGG + Intergenic
969417135 4:7068198-7068220 TCCCCACCCCCCGGTGGGCGGGG + Intergenic
969460225 4:7325117-7325139 TCCCCAGGCCCCCTTGGGTGGGG + Intronic
969607606 4:8210310-8210332 CCCCCAACCCCCCGCTGGGGAGG + Intronic
971279926 4:25234358-25234380 CCCCCACGTCCCCGGGCGGGAGG - Exonic
972765953 4:42152312-42152334 TCGCCGAGCCCCCGCGCGGGGGG + Exonic
974549249 4:63349695-63349717 TCCCCGCGCCCCCTCGCTGGTGG - Intergenic
978947598 4:114516843-114516865 TCCCCACTTCCCAGCAGGGGTGG - Intergenic
980486291 4:133461588-133461610 TCCCAACACCTCCCCGGGGGAGG - Intergenic
984811096 4:183797358-183797380 GCCCAGCGGCCCCGCGGGGGCGG - Intergenic
984917016 4:184734045-184734067 GCACCATGGCCCCGCGGGGGCGG - Exonic
985578049 5:682740-682762 TGCCCACGCCCACGCGGGGGTGG + Intronic
985592976 5:774881-774903 TGCCCACGCCCACGCGGGGGTGG + Intergenic
985995457 5:3595016-3595038 CCCCCGCGCCCCCGCGAAGGGGG - Intergenic
990003599 5:50922074-50922096 CCCACACGCCCCCTCGGGGCTGG - Intergenic
992228553 5:74641384-74641406 TCCCCACTCCCCAGTGGGTGCGG + Exonic
994171402 5:96662602-96662624 CCCCGGCGCCCCCGCGGGGCAGG + Intronic
1002187119 5:177459570-177459592 GCCCCAGGCCTCGGCGGGGGTGG - Intronic
1002512581 5:179732718-179732740 TCCCCACGCCCTCGGGCGGCCGG + Intergenic
1003545099 6:7052135-7052157 TCCCCGCTCCGCCTCGGGGGAGG + Intergenic
1006137084 6:31901877-31901899 TCCCCACCCCCCCCCGGGGCCGG + Exonic
1006408533 6:33858729-33858751 TCCCCAAGCCCCAGCGGTGCCGG + Intergenic
1007739514 6:44002280-44002302 CTGCCACGGCCCCGCGGGGGAGG - Intronic
1007784136 6:44270610-44270632 TCCCCACCCCCCGCCGGGGGAGG - Exonic
1017324585 6:153130975-153130997 CGCCCATGCCCCGGCGGGGGCGG - Intronic
1017662422 6:156687445-156687467 CCCCCACGCCCCGGCCGCGGCGG + Intergenic
1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG + Intronic
1017844078 6:158241092-158241114 TCCTCACGTCCCAGAGGGGGCGG + Intronic
1019307309 7:341950-341972 TCCTCACGCCCCAGCAGGTGTGG - Intergenic
1019328732 7:452464-452486 GCCCCACGCCCCAGGGAGGGAGG + Intergenic
1019540323 7:1548322-1548344 TCCCCACTCCCCCGTGCTGGCGG + Intronic
1019548871 7:1592406-1592428 TCCCCACACCCCCGCAGAGTGGG - Intergenic
1020091497 7:5344706-5344728 TCCCCTGGCCCCAGCAGGGGAGG - Intronic
1020268438 7:6577505-6577527 TTCCCACAGCCCCGCGGAGGCGG - Exonic
1020278432 7:6637867-6637889 TCCGGACGCCCCCTGGGGGGCGG + Exonic
1029604493 7:101590418-101590440 GCACCAGGCCACCGCGGGGGTGG - Intergenic
1031008377 7:116499547-116499569 TCCCTGCGCCCCGGCGGGGGAGG + Exonic
1032196596 7:129792908-129792930 TTCCCAGCCCCCCGCCGGGGAGG + Intergenic
1035252508 7:157606336-157606358 CCCCCACCCCCACGCTGGGGAGG - Intronic
1035301834 7:157902342-157902364 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301850 7:157902410-157902432 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301861 7:157902444-157902466 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1036156952 8:6350918-6350940 TCCCCAAGCTCCCCCTGGGGTGG - Intergenic
1036786674 8:11692649-11692671 CCCGCACGCACCCGCGGTGGAGG - Intronic
1037876032 8:22548968-22548990 CCCCCACCCCCCTGCAGGGGAGG - Intronic
1037877208 8:22554100-22554122 TCCCCACTCCCCCGGAGGGAAGG - Intronic
1040965538 8:53077719-53077741 TGCCCAAGCCCCCCCGGGGTGGG - Intergenic
1041070709 8:54125175-54125197 TCCTCACGTCCCAGAGGGGGCGG - Intergenic
1041166251 8:55095696-55095718 TGCCCAAGCCCCCACTGGGGTGG + Intergenic
1041201589 8:55455075-55455097 TTCCCACTCCCGCGCGGGTGCGG + Intronic
1043476813 8:80613249-80613271 TCACGACGGCCCCGCGGGTGTGG - Intergenic
1044306401 8:90645749-90645771 TCGCCCCGCCCCCGCGGGGAAGG + Exonic
1048073075 8:131041136-131041158 TCCCCACACCCCCTCCGGGAGGG - Exonic
1048891868 8:138955541-138955563 TCCCAACGTCCACGTGGGGGAGG - Intergenic
1049455234 8:142683248-142683270 TCCCCAGGCCCCTGAGTGGGAGG + Intergenic
1049850529 8:144827792-144827814 ACCTCGCGCCGCCGCGGGGGAGG - Intronic
1050417979 9:5434594-5434616 TCCCCACCTCCCAGAGGGGGCGG - Intronic
1051566482 9:18504898-18504920 TGCTCACGCACCTGCGGGGGTGG + Exonic
1052732933 9:32310894-32310916 TCCCCATGGCCCCGTGGTGGTGG + Intergenic
1053001467 9:34579153-34579175 TCCCTTCGCCCCTGTGGGGGAGG + Intronic
1057489570 9:95510876-95510898 TCCCCGCGCCCGCGCGGCCGGGG + Intronic
1057895601 9:98906356-98906378 TCCCTACTCACCCGCTGGGGTGG + Intergenic
1060114481 9:120929234-120929256 TCCCCAGACCGCCGCGGGGCGGG + Intergenic
1061000304 9:127899062-127899084 CCCCCACGAACCCGCGTGGGAGG + Intronic
1061073008 9:128323160-128323182 GCGCCTCGCCCCCGTGGGGGCGG + Intronic
1061397204 9:130349627-130349649 TCCCCACGCCCCAGGTGGAGTGG + Intronic
1061727616 9:132590105-132590127 TCCCCACTCCCAGGCGGGGCAGG + Exonic
1062362092 9:136193038-136193060 TCCCCCCCCCCCCGCGGCTGGGG - Intergenic
1062423293 9:136494291-136494313 TCCCCACACCCCCGTGGGCCAGG + Intergenic
1062625945 9:137441568-137441590 TCGCCCCGCCCCCGGGGGGGTGG + Intronic
1203750965 Un_GL000218v1:79764-79786 TCCCCAGGCCCCAGCAGTGGTGG + Intergenic
1203483019 Un_GL000224v1:24580-24602 TCCCCAGGCCCCAGCAGTGGTGG - Intergenic
1185778815 X:2828863-2828885 TCCGCCAGCCCCCGCGGGCGCGG - Exonic
1188477053 X:30602141-30602163 TCCTCACGTCCCAGAGGGGGCGG - Intergenic
1192118593 X:68433940-68433962 TCCCCACCACCCCGCCTGGGAGG + Intergenic
1199616431 X:149659622-149659644 TCCTCACGCCCCTCCTGGGGTGG - Intergenic
1199626210 X:149743626-149743648 TCCTCACGCCCCTCCTGGGGTGG + Intergenic
1200003293 X:153072776-153072798 GCCCCGCCCCCCCGGGGGGGTGG - Intronic
1200004430 X:153077233-153077255 GCCCCGCCCCCCCGGGGGGGTGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic