ID: 930013244

View in Genome Browser
Species Human (GRCh38)
Location 2:46953961-46953983
Sequence GGGTCTCAAGAGATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930013244_930013249 0 Left 930013244 2:46953961-46953983 CCAAGCTCCATCTCTTGAGACCC 0: 1
1: 0
2: 0
3: 35
4: 274
Right 930013249 2:46953984-46954006 AAGAAAGGTGATCACAACCCAGG 0: 1
1: 0
2: 0
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930013244 Original CRISPR GGGTCTCAAGAGATGGAGCT TGG (reversed) Intronic
900486027 1:2923197-2923219 GGGTCCTGAGAGATGGAGCACGG - Intergenic
901114731 1:6834021-6834043 GGGTCTTAGGTGATGGCGCTTGG + Intronic
903337976 1:22637540-22637562 GGGACTCAAGGGTGGGAGCTGGG + Intronic
904315248 1:29655957-29655979 GGGTCTCAAGAGGAGGAGCAAGG - Intergenic
905769157 1:40626163-40626185 GAGTCTCCAGGGATGGAGGTGGG - Exonic
906480677 1:46197365-46197387 TGGTTTCTAGAGATGGAGCCAGG + Intronic
908275577 1:62467302-62467324 GGGTTTCAAGATATGGATCTTGG + Intronic
909562847 1:77024885-77024907 GGGTCACAGCAGATGGAGTTGGG - Intronic
910028496 1:82687560-82687582 GGGTTTTAAGAGTTGGATCTTGG + Intergenic
910484440 1:87697242-87697264 GGGTTTCAAGATTTGGATCTTGG + Intergenic
911870692 1:103094158-103094180 GGGTTTCAAGATATGGATCTTGG + Intronic
913647204 1:120869549-120869571 GGGTTGCAAGATATGGATCTTGG + Intergenic
914299248 1:146364492-146364514 GGGTTGCAAGATATGGATCTTGG - Intergenic
914529005 1:148503035-148503057 GGGTTGCAAGATATGGATCTTGG - Intergenic
914637387 1:149564065-149564087 GGGTTGCAAGATATGGATCTTGG + Intergenic
915203821 1:154254042-154254064 GGTGATGAAGAGATGGAGCTGGG - Exonic
915500638 1:156314357-156314379 GGGTTTCAAGATATGAATCTTGG + Intronic
915800381 1:158785437-158785459 GGCTTTCAAGAGAAGGATCTAGG - Intergenic
915851937 1:159333469-159333491 GGGTTTCAAGATATGGATCTCGG - Intergenic
917071569 1:171157070-171157092 GGGTTTCAAGATATGGATCATGG + Intronic
918085771 1:181244023-181244045 AGGTCTCAAGAGAGGCAGCATGG + Intergenic
918601314 1:186365829-186365851 GGGTTTCAAGATACGGACCTTGG + Intronic
918629158 1:186695047-186695069 GGGTTTCAAGATATGGATCTTGG + Intergenic
918953604 1:191174822-191174844 GAGTTTCAAGATATGGATCTTGG - Intergenic
919861512 1:201741806-201741828 GGTTCCCATGAGATGGAGTTGGG - Intronic
920680624 1:208069723-208069745 GGGTCTCTAGAACGGGAGCTGGG - Intronic
922422119 1:225467234-225467256 GCGTCTCAAGACAGGAAGCTCGG + Intergenic
922755690 1:228095646-228095668 GGGACCCAAGGGATGAAGCTGGG - Intronic
924558433 1:245137227-245137249 CAGTCTCAATAGATGGTGCTGGG - Intergenic
1066562777 10:36688837-36688859 GGTTCTCAGGAGAAGGAGCCAGG + Intergenic
1067716886 10:48696949-48696971 GGTTAGGAAGAGATGGAGCTGGG + Intronic
1067961933 10:50864108-50864130 GGGTCAAAAAAGATGGAGATTGG + Intronic
1068063760 10:52102624-52102646 GGGTTTCAAGATAGGGATCTTGG + Intronic
1068298192 10:55103412-55103434 GGGTTTCAAAATATGGATCTTGG - Intronic
1068629696 10:59286567-59286589 GGTTATCAAGAGCTGGTGCTGGG + Intronic
1069733248 10:70632956-70632978 GGGTTTCAAGATATGGATCTTGG + Intergenic
1069776155 10:70928480-70928502 GGGGAGCAGGAGATGGAGCTGGG + Intergenic
1070662097 10:78314331-78314353 GGGCCTGAAGAGATAGATCTGGG + Intergenic
1072167733 10:92830187-92830209 GGGTCCCAAGAGAGGGTTCTTGG - Intergenic
1072783954 10:98268123-98268145 GGGGCTCACCAGATGGAGCGCGG + Exonic
1074531093 10:114299403-114299425 GGGTCTGTAGAGATCAAGCTTGG - Exonic
1075148618 10:119905973-119905995 TGACCTCAAGAAATGGAGCTAGG + Intronic
1075842450 10:125516486-125516508 TGGCCTCTGGAGATGGAGCTTGG + Intergenic
1076993070 11:285545-285567 GGGTCTCAGGAGAGGAAGGTGGG - Intergenic
1078830512 11:14972838-14972860 GGGAAACAAGAGACGGAGCTGGG + Intronic
1080583674 11:33663571-33663593 GGGTCTCAGGAGTTGGACATTGG + Intronic
1081772228 11:45657094-45657116 GGGTCCCAAGAACTGGAGCAAGG + Intronic
1081949680 11:47033533-47033555 GGGTCCCAAGATATGGATCTTGG - Intronic
1081980276 11:47261784-47261806 GGGCCTCCAGACATCGAGCTGGG + Intronic
1083612250 11:64009877-64009899 GGGGCTCAGAAGATGGGGCTGGG - Intronic
1085489405 11:76900842-76900864 GGGTTTCAAGATATGAACCTTGG - Intronic
1085871908 11:80360220-80360242 GAGTTTCAAGATATGGATCTTGG - Intergenic
1087161585 11:94953487-94953509 GGGTTTCAAGATGTGGATCTTGG - Intergenic
1088547537 11:110974908-110974930 GGCTAACAAGAGATGGAGCCAGG - Intergenic
1088661574 11:112052670-112052692 GGGTCTTAATAGAGGGGGCTGGG + Intronic
1088781139 11:113135407-113135429 GGGTCTGCAGAGATTGAGCATGG + Intronic
1088812754 11:113402542-113402564 GAGACTAAAGAGATTGAGCTGGG - Intergenic
1089273271 11:117315883-117315905 GCTTCTCAGGAGAGGGAGCTTGG + Exonic
1090646925 11:128773818-128773840 GGGCCTGAAAAGATGGTGCTAGG + Intronic
1091387276 12:103332-103354 GGGGCTCAGGAGAAGGAGGTGGG + Intronic
1091809992 12:3389158-3389180 GGGTACCGAGAGATGGAGGTGGG + Intronic
1092481239 12:8860965-8860987 GGGTATCAAGAGCAGGAGCCAGG - Intronic
1095743994 12:45636995-45637017 GGTTTTCAACAGATGGTGCTGGG + Intergenic
1096769695 12:53927304-53927326 TGGTCTCAAGAAATGGGGCAGGG - Intergenic
1097943773 12:65343692-65343714 GGGTAGTAAGAGATGGAGCTAGG + Intronic
1101471970 12:105006043-105006065 GGGTTTCAAGACAGGGATCTTGG - Intronic
1102756230 12:115343168-115343190 GGGTGGCAAGAGAGAGAGCTTGG + Intergenic
1103943764 12:124514939-124514961 GGGTCTGGAGAGATGGGGGTGGG - Intronic
1105968449 13:25405540-25405562 GGGTCTCAAGAGAGCACGCTGGG - Intronic
1108441208 13:50454611-50454633 GAGTGTCAAGAACTGGAGCTGGG + Intronic
1108743913 13:53370013-53370035 GGGTCTGAGGATATGGAGGTGGG + Intergenic
1112512996 13:100026508-100026530 GGGTTTTAAGATATGGATCTTGG + Intergenic
1113306806 13:109088299-109088321 GCTGCTCAGGAGATGGAGCTTGG + Intronic
1114439647 14:22735955-22735977 GGGTCTCAAGAGAGGGAAAATGG - Intergenic
1114571451 14:23672071-23672093 GGGACTGAAGGGAGGGAGCTGGG + Intergenic
1117777506 14:59197835-59197857 GGCTCCCAAGATATGGAACTTGG - Intronic
1119092314 14:71796115-71796137 GGATTTCAAGAGATAGATCTGGG + Intergenic
1119466672 14:74863677-74863699 GGGTCTGTAGGGCTGGAGCTGGG + Exonic
1119888345 14:78163512-78163534 GGGCCTTAGGAGATGGAGCAGGG + Intergenic
1120934754 14:89883878-89883900 GCTACTCAAGAGATGGAGGTGGG + Intronic
1121680362 14:95788253-95788275 GGGTCTCCCTAGGTGGAGCTGGG - Intergenic
1121888018 14:97562407-97562429 AGGTCACAAGACATGGAGCAGGG + Intergenic
1122505067 14:102226971-102226993 GGGCCTCAAGTGGTGGACCTTGG + Intronic
1122763812 14:104050662-104050684 GGGTCTCTAAAGAGGGACCTAGG - Intronic
1123020530 14:105395872-105395894 GGGTCTCCATAGGAGGAGCTGGG + Exonic
1123441290 15:20294049-20294071 AGTTTTCAAGAGATGGAGGTGGG + Intergenic
1124155162 15:27219090-27219112 GGGTCTCAGGGGAAGAAGCTAGG - Intronic
1125311642 15:38385529-38385551 GGGTTTCAAGATACGGATCTAGG + Intergenic
1128254472 15:66186591-66186613 GGGGCTCGAGAGATGGAGACAGG - Intronic
1128649928 15:69403102-69403124 GGCTCTCAAGAGATGAACTTTGG + Intronic
1128799786 15:70490148-70490170 GGGTCAGATGACATGGAGCTGGG - Intergenic
1130054584 15:80511608-80511630 GGGGCTGAAGATATGGACCTGGG + Intronic
1131071152 15:89466784-89466806 GGATCCCAAGAGCTGGAGCCTGG - Intergenic
1131303213 15:91218219-91218241 TGGTCTCATGAGAATGAGCTGGG + Intronic
1131352365 15:91712933-91712955 GGGTCTCAGGAGTTGGAGAAGGG - Intergenic
1132358283 15:101189903-101189925 AGGACTCAAGTGGTGGAGCTGGG - Intronic
1133221569 16:4321170-4321192 GCGTGGCAGGAGATGGAGCTGGG + Intronic
1133378975 16:5314082-5314104 GGGTCTCATGAGATAAAACTTGG - Intergenic
1140229930 16:73109077-73109099 AGGACTTGAGAGATGGAGCTGGG + Intergenic
1141392712 16:83678092-83678114 GGGCCTTCAGGGATGGAGCTGGG - Intronic
1143120814 17:4605619-4605641 AGCTCGGAAGAGATGGAGCTGGG + Intronic
1143803468 17:9404936-9404958 GGGTTTCAAGATAGGGATCTTGG - Intronic
1144354149 17:14428210-14428232 GGGTCTCAATATATCCAGCTAGG - Intergenic
1147336628 17:39730295-39730317 GGGAGTCAAGAGATGGGGCTGGG + Intronic
1147381518 17:40059084-40059106 GGGTCACAAAAGAGGGAGCCAGG - Intronic
1148181244 17:45606524-45606546 TGGACTCCAGAGATGGGGCTTGG - Intergenic
1148267666 17:46239421-46239443 TGGACTCCAGAGATGGGGCTTGG + Intergenic
1150892353 17:69167551-69167573 GGGTTTCAAGACCTGGATCTTGG + Intronic
1152019027 17:77770855-77770877 TGGTCTCAGGGGATGGAGCCTGG - Intergenic
1153106402 18:1533175-1533197 GGGGCTCAATAGATGGCTCTAGG - Intergenic
1153229814 18:2924981-2925003 GACTCTCAAGAGATGGAGGAAGG + Intronic
1153754411 18:8265367-8265389 GGCTCTCAAGAGCTGTAGCTTGG - Intronic
1154316346 18:13306854-13306876 GGATTTCAAGATATGGATCTTGG + Intronic
1155311503 18:24528893-24528915 GGGTTCCTAGAGAAGGAGCTAGG - Intergenic
1156016351 18:32551282-32551304 GCCTCTCAAGTGATGGAGTTGGG - Intergenic
1156038393 18:32792630-32792652 GGATTTCAAGATATGGATCTTGG - Intergenic
1156120836 18:33841103-33841125 GGGTCTCTAGGGAGAGAGCTGGG + Intergenic
1157046659 18:44108214-44108236 GGGTTTCAAGATAGGGATCTTGG + Intergenic
1157809193 18:50681649-50681671 TGTTTTCAAGAGATGGTGCTGGG - Intronic
1158123054 18:54071365-54071387 GGATATCAGGAGATAGAGCTTGG - Intergenic
1159067035 18:63581472-63581494 GGATTTCAAGATATGGATCTTGG + Intergenic
1160754933 19:752137-752159 GGTTTTCGAGAGAGGGAGCTGGG - Intronic
1160843798 19:1157843-1157865 CGGACTCAAGAGAGAGAGCTGGG - Intronic
1163624362 19:18380421-18380443 GGGTCCCCAGAGGTGGAGCTGGG - Intronic
1163785361 19:19272419-19272441 GGATCCCAGGAGATGGAGATGGG + Intronic
1165877672 19:39020786-39020808 GGGTTTCAAGCCATGGATCTTGG + Intronic
1166309798 19:41956639-41956661 GGGTCTCTATGGGTGGAGCTGGG - Intergenic
1166460669 19:42985274-42985296 GGGTGTCAAGAGATGGGGAGAGG - Intronic
1166504392 19:43361955-43361977 GGGTCTGAGGAGCTGGAGCTGGG + Intronic
1167717356 19:51152336-51152358 GGGACTTTACAGATGGAGCTAGG - Intronic
925651479 2:6094123-6094145 GGGTTTCAAGGTATGGATCTTGG - Intergenic
928816354 2:35299295-35299317 AGAACTTAAGAGATGGAGCTTGG + Intergenic
929204657 2:39277206-39277228 TGGTAACAATAGATGGAGCTGGG - Intronic
929229984 2:39549535-39549557 GGGTTTCAAGAAATGTTGCTAGG - Intergenic
929355821 2:41023047-41023069 GTGTTTCAAGATATGGATCTTGG + Intergenic
929912678 2:46104262-46104284 GGGTTTCAAGATAGGGATCTTGG - Intronic
929992967 2:46804948-46804970 GGGGCACAAGAGTTGGAGTTTGG - Intergenic
929996074 2:46826953-46826975 GGGCATCAAGAGATGGACCTGGG + Intronic
930013244 2:46953961-46953983 GGGTCTCAAGAGATGGAGCTTGG - Intronic
930053745 2:47236527-47236549 GGGTCTCAGGACAGGGAGTTGGG + Intergenic
930937977 2:56979876-56979898 GGGTTTCAAGATATGGATCTTGG + Intergenic
931409466 2:62015179-62015201 GGGGCTGAAGAGATGGAAATTGG - Intronic
932029298 2:68166907-68166929 GGGTTTCAAGATATGGATCACGG - Intronic
932989975 2:76775045-76775067 GGGTTTCAAGATATGTATCTTGG - Intronic
933485362 2:82915285-82915307 GAGTTTCAAGATATGGATCTCGG - Intergenic
933850352 2:86361552-86361574 AGGTCCCAAGAGATGGCCCTAGG - Intergenic
934650158 2:96085961-96085983 GGATCCCCAGAGGTGGAGCTGGG - Intergenic
934987928 2:98900700-98900722 TGGTCCCAAGAGATGGAGAAAGG + Intronic
935237222 2:101149719-101149741 GGCTCTCAGGAAATGGAGGTGGG - Intronic
935473621 2:103490381-103490403 GGGTTTCAAGGTATGGATCTTGG + Intergenic
935632070 2:105220174-105220196 GGTACTCAAGAGAGGGAGCTGGG + Intergenic
936998732 2:118441960-118441982 AGGTTTCCAGAGATGGAACTGGG - Intergenic
937070724 2:119061072-119061094 GGATCCCAAGAAAGGGAGCTGGG - Intergenic
938725741 2:134107577-134107599 TGGTCCCAAGAGATGGATTTGGG - Intergenic
940333126 2:152497050-152497072 CGTTCTCAACAGATAGAGCTAGG + Intronic
941033692 2:160542326-160542348 GCTACTCAAGAGATGGAGGTGGG - Intergenic
941937908 2:171000982-171001004 GGGTTTCAAGATATGGATCTTGG - Intronic
942013455 2:171787921-171787943 GGGTCACCAGAGATGCAGCTGGG + Exonic
943442879 2:187947759-187947781 TGGACTCCAGAGATGGGGCTTGG + Intergenic
946006910 2:216533186-216533208 GGCTGTTAAGGGATGGAGCTAGG - Intronic
947206783 2:227667998-227668020 CGATCTCAAGAGATGGAGAAAGG - Intergenic
947225168 2:227832689-227832711 GCTTCTCAAGAGATTGAGATGGG + Intergenic
948287239 2:236795361-236795383 GGGTTTAAAGAAATGGAGTTTGG + Intergenic
1168755071 20:310566-310588 GGGCCTCTGGCGATGGAGCTCGG - Intergenic
1169915027 20:10674910-10674932 GGGTGGCAAGAGATGGGCCTGGG + Intergenic
1170602528 20:17851974-17851996 GGGTTTCAAGATATGGATTTTGG - Intergenic
1173223148 20:41145801-41145823 TGGTCCCAAGAGATGGGACTTGG + Intronic
1173500061 20:43546627-43546649 GGGGGTCAAGAGACTGAGCTGGG - Intronic
1174418972 20:50386918-50386940 GAGTCCCAAGAGGTGGAGATTGG - Intergenic
1174724361 20:52845718-52845740 GGGGATTAAGAGATGGAGTTTGG - Intergenic
1177450541 21:21259446-21259468 AGGTCTCAAGAGAAGGGGCTGGG - Intronic
1177503512 21:21990329-21990351 GGGTTTCAAGATATAGATCTTGG + Intergenic
1178127504 21:29530892-29530914 GGATCTGGAGAGATGGAGGTGGG + Intronic
1181172521 22:21017771-21017793 TTGTCTCAAGAGATGGACATGGG + Intronic
1181176830 22:21042610-21042632 TTGTCTCAAGAGATGGACATGGG - Intergenic
1181311299 22:21946294-21946316 CGGTCTCAGGAGATGGTGCCAGG + Intronic
1181771453 22:25128681-25128703 GGGTGCAAAGAGATGGGGCTGGG - Intronic
1181853085 22:25764033-25764055 GGGACTCAGGAGAGGGACCTGGG - Intronic
1182497761 22:30722120-30722142 GTGTCTCAAGACAAGAAGCTGGG - Intronic
1182785046 22:32900273-32900295 GGATCTGAAAAGATGGTGCTGGG - Intronic
1183272352 22:36870051-36870073 GGATGTCATGAGATGGAGCAAGG + Intronic
1183429539 22:37757421-37757443 GGCTGTCAAGAGGTGGAGCTGGG + Intronic
1184384142 22:44164719-44164741 GGGACTCAGGAGAGGGAGCAGGG - Intronic
1185255985 22:49831808-49831830 GGGTCTCAAGAGAAGCAGGTGGG + Intergenic
949731178 3:7114952-7114974 GGCCCTCATGAGAAGGAGCTCGG + Intronic
951741105 3:25924588-25924610 GGAGCTCAAAAGATGAAGCTTGG + Intergenic
951875046 3:27414807-27414829 GGGTTTCAAGATGTGGATCTTGG - Intronic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
953204129 3:40806165-40806187 GGGTTTCAAGATATGGATTTTGG + Intergenic
953461984 3:43088815-43088837 GGATGTCCAGAGATGGGGCTTGG - Intronic
954884729 3:53862552-53862574 GGGTTTCAAGATACGGATCTTGG + Intronic
955382589 3:58451894-58451916 GGGTTTCAAGATATGGATCTTGG - Intergenic
957979965 3:87496026-87496048 GGGTTTAAAGATATGGATCTTGG - Intergenic
959378408 3:105612932-105612954 GTTTCTCCAGAGATGGGGCTGGG - Intergenic
960084206 3:113573307-113573329 GGGGCTCAGGAGATGGCCCTGGG + Intronic
960799696 3:121525859-121525881 GGGTTTCAAGATATGAATCTTGG - Intronic
964033961 3:152172787-152172809 GGGTTTCAAGATTTGGATCTTGG + Intergenic
965061608 3:163791078-163791100 GGGTCTCAAGATAAGAATCTTGG - Intergenic
969560343 4:7942661-7942683 GGGTCTCACGCTAAGGAGCTGGG - Intergenic
970927594 4:21470947-21470969 GGGTCTCAAAATATGGCTCTTGG + Intronic
974598875 4:64050246-64050268 TGGACTCAAGAGATCGAGATGGG - Intergenic
976245318 4:83001248-83001270 GGGTTTCAAGATATGCATCTTGG + Intronic
976426801 4:84913461-84913483 GGGTTTCAAAATATGGATCTTGG + Intronic
976644988 4:87377991-87378013 GGCTATTAAAAGATGGAGCTGGG + Intronic
976754867 4:88487381-88487403 TGGTAGCAAGGGATGGAGCTTGG + Intronic
977544281 4:98358566-98358588 TGGTCTCAAGAAATAGAACTTGG - Intronic
979016112 4:115435812-115435834 GGGTTTCAGGATATGGATCTTGG + Intergenic
980986149 4:139696582-139696604 GGGTCTCAAGATATGAATCTTGG - Intronic
981056269 4:140365200-140365222 GGGTTTCAAGATCTGGATCTTGG + Intronic
981170456 4:141616665-141616687 GGGTTTCAAGATATGGATCTTGG - Intergenic
981571687 4:146158354-146158376 GGATTTCAAGAAATGGATCTTGG + Intergenic
981571742 4:146158951-146158973 GGGTTTCAAGATAAGGATCTTGG - Intergenic
983248781 4:165320843-165320865 GGGTTTCAAGGTATGGATCTTGG + Intronic
984419900 4:179507577-179507599 GGGTTTCAAGATATGGATCATGG - Intergenic
985143068 4:186863065-186863087 GGGGCTCAAGAGATGTAGGGAGG - Intergenic
986509281 5:8486383-8486405 GGGTTTCAAGATATGGGTCTTGG + Intergenic
986683929 5:10259493-10259515 GTGTCTCAAGAGCACGAGCTTGG - Intronic
988577244 5:32438938-32438960 GTGCCTGAAGGGATGGAGCTGGG + Intronic
988695541 5:33618694-33618716 GGGTTTCAAGATATGGATTTTGG - Intronic
988880166 5:35493970-35493992 GGGTTTCAAGATATGGATATTGG - Intergenic
990615972 5:57508747-57508769 GGGACTCCAGAGGTGGAGCTTGG + Intergenic
990792277 5:59495664-59495686 GGGTGGCAAGACATGCAGCTAGG + Intronic
993929610 5:93922309-93922331 GGGTTTCAAGATAAGGATCTTGG + Intronic
995061645 5:107817184-107817206 GGAGCTCCAGAGATGGAGGTGGG + Intergenic
997391967 5:133524603-133524625 GGGTCCAAAGAGACGCAGCTTGG - Intronic
997529398 5:134572671-134572693 GTGTCTCAAGGGAGGGGGCTTGG + Intronic
999412222 5:151360906-151360928 GGGTTTCAAGATATGGATCTTGG - Intergenic
999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG + Intergenic
1000013865 5:157260076-157260098 GCGTCTCAACATATGGATCTTGG - Intergenic
1001344916 5:170885833-170885855 GGGTTTCAAGATATGGATCTTGG - Intronic
1001577646 5:172774536-172774558 TGCTCTCAAGAGAGGGAGCAGGG + Intergenic
1004002420 6:11607387-11607409 GGGACTCAGGAGCTGGAGCCAGG - Intergenic
1004111179 6:12720475-12720497 GGTTTTCAGCAGATGGAGCTGGG + Intronic
1004840641 6:19580163-19580185 GGGTTTCAAGATATGGATCTTGG + Intergenic
1007188840 6:39996527-39996549 GGGCCTGAAGAGATGGAGCCTGG + Intergenic
1007732813 6:43959435-43959457 GGATTTCAAGATATGGATCTTGG + Intergenic
1008855902 6:56087026-56087048 GGGTCCCAAGATATGGATCGTGG - Intronic
1010165910 6:72914810-72914832 GGGTCTCAAGCCAGGGGGCTCGG + Intronic
1010395707 6:75389830-75389852 GAGTCTCAGGAGATGGGGATAGG - Intronic
1010654043 6:78490723-78490745 AGTTCTCAAGAGAAGGGGCTTGG - Intergenic
1011123473 6:83980886-83980908 CGGTCTCAATAAATGGTGCTGGG - Intergenic
1013412131 6:109891854-109891876 GGGCCTAAGGAGATGGAGCCCGG + Intergenic
1016180742 6:141145144-141145166 GGGTTTTAAGATATGGATCTTGG + Intergenic
1016983008 6:149870117-149870139 TGGTCCCAAGAGAAGGAACTGGG - Intergenic
1019127490 6:169850631-169850653 GGATCTCAAGACAGAGAGCTGGG - Intergenic
1019293371 7:261158-261180 GGGGCTGCAGAGATGGGGCTGGG + Intergenic
1019616726 7:1966373-1966395 GGGGCTGAGGAGATGGGGCTGGG + Intronic
1019710899 7:2517780-2517802 GGGCCTCAAGAAACGGGGCTGGG + Intronic
1021966416 7:25924182-25924204 GGATTACAAGAGGTGGAGCTAGG - Intergenic
1022145913 7:27540400-27540422 GGCTTTCAAGATATGGATCTTGG - Intronic
1023769781 7:43546184-43546206 GGGTTTCAAGATATAGATCTTGG - Intronic
1024622395 7:51173115-51173137 GGGCCTGAAGTGATGGAGTTAGG + Intronic
1025252038 7:57358080-57358102 GAGTCCCAAGAGGTGGAGATTGG + Intergenic
1027130452 7:75586691-75586713 GGGGCTGAAGGGATGGAGCAGGG + Intronic
1027263151 7:76479241-76479263 AGGTCTCGGGAGGTGGAGCTCGG + Intronic
1027314535 7:76977346-76977368 AGGTCTCGGGAGGTGGAGCTCGG + Intergenic
1028058326 7:86276837-86276859 GGGTTTCAAGATACGGATCTTGG + Intergenic
1029725038 7:102397240-102397262 TGGTCTTAAGAGATGTAACTTGG + Intronic
1030303583 7:107998441-107998463 GGGTCTCATGATAAGGATCTTGG + Exonic
1031060724 7:117048564-117048586 GGGTTTCAAGATATGGATCTTGG - Intronic
1031379977 7:121073771-121073793 GGGTTTCAAGATATGGATCTTGG - Intronic
1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG + Intronic
1034948573 7:155280773-155280795 GCGTCACCAGAGATGGGGCTGGG - Intergenic
1038591509 8:28842633-28842655 ACGTTTCAAGATATGGAGCTTGG - Intronic
1039510562 8:38088720-38088742 GGGCCTAATGAGATGGAGCCCGG + Intergenic
1039913706 8:41844427-41844449 GGGGCTCAGGCGATGGAGGTTGG - Intronic
1041353455 8:56973583-56973605 GGGTTTCAAGATAGGGATCTTGG + Intronic
1042878064 8:73457914-73457936 GGGTCTCAGGAGAGGGACCTAGG + Intronic
1046227018 8:111295613-111295635 AGGTTTCAAGATATGGATCTTGG - Intergenic
1046446348 8:114325576-114325598 GGGTTTCAAGTTATGGATCTTGG - Intergenic
1048770326 8:137888094-137888116 GGGTTTGAAGATGTGGAGCTGGG - Intergenic
1048868027 8:138775163-138775185 GTGTCCCAAGAGCTGGGGCTAGG - Intronic
1048982536 8:139710559-139710581 GGGCATCCAGAGAGGGAGCTGGG - Intergenic
1049455084 8:142682604-142682626 GAGTCTCCAGAGATGGGGCCTGG + Exonic
1051647567 9:19283892-19283914 GTGTCTCAAGAAATGCATCTGGG - Intronic
1054459613 9:65455671-65455693 GGGGCTCAGGAGAGGGAGATGGG - Intergenic
1056953710 9:91065936-91065958 AGGAGTCAAGAGATGGTGCTGGG + Intergenic
1057025424 9:91731381-91731403 GGGTCCCAAGAGATGGTTCTGGG - Intronic
1057187633 9:93065829-93065851 ATGTCTCCAGATATGGAGCTTGG + Intronic
1057536989 9:95919808-95919830 GGGTTTCAAGAGACGGATCTTGG + Intronic
1058010726 9:99973854-99973876 GAGTTTCAAGAGATAAAGCTGGG - Intergenic
1058116633 9:101092021-101092043 GAGTGTCAAGAGAAGCAGCTGGG - Intronic
1058894964 9:109391790-109391812 GGGTCTCAGGTAATGGAGCATGG + Intronic
1058982894 9:110186637-110186659 GGGTTTCAAGAGAGTGAGCAGGG + Intergenic
1060498186 9:124133240-124133262 GAGACTCAAGAGATGGAGTGAGG + Intergenic
1060828986 9:126702133-126702155 GGGTCTCTAGAGATGGTGGCAGG + Intergenic
1060912617 9:127362953-127362975 GCCTCTGAAGTGATGGAGCTGGG + Intronic
1061555850 9:131368400-131368422 TGGTATAAAGAGATGGGGCTGGG + Intergenic
1062432193 9:136531214-136531236 GGGTCCCATGAGACAGAGCTTGG - Intronic
1203760739 EBV:12225-12247 GGGTCTTCAGGGATGGGGCTTGG - Intergenic
1203761668 EBV:15297-15319 GGGTCTTCAGGGATGGGGCTTGG - Intergenic
1203762597 EBV:18369-18391 GGGTCTTCAGGGATGGGGCTTGG - Intergenic
1203763526 EBV:21441-21463 GGGTCTTCAGGGATGGGGCTTGG - Intergenic
1203764455 EBV:24513-24535 GGGTCTTCAGGGATGGGGCTTGG - Intergenic
1203765384 EBV:27585-27607 GGGTCTTCAGGGATGGGGCTTGG - Intergenic
1203766313 EBV:30657-30679 GGGTCTTCAGGGATGGGGCTTGG - Intergenic
1203767242 EBV:33729-33751 GGGTCTTCAGGGATGGGGCTTGG - Intergenic
1203489565 Un_GL000224v1:90592-90614 GGTACTCAACAGATGCAGCTGGG - Intergenic
1186188037 X:7040840-7040862 GGGTGTCAAGAGATGGGGAGAGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1190631454 X:52391203-52391225 GGGACTCAAGAACTGAAGCTAGG - Intergenic
1191022155 X:55873582-55873604 GGGTTTCAAGATATGGATCTTGG - Intergenic
1191196765 X:57732099-57732121 TGGTCTCAAGAGATAAATCTGGG - Intergenic
1196095921 X:111799793-111799815 GGGTTTCAAGATATGGGTCTTGG + Intronic
1196199352 X:112867965-112867987 CAGTGTTAAGAGATGGAGCTAGG + Intergenic
1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG + Intergenic
1196875105 X:120149555-120149577 GGGCCTAAAAAGATGGAGCCTGG - Intergenic
1198456011 X:136818685-136818707 GGGTTTCAAGATATGGATCTTGG - Intergenic
1199701927 X:150386069-150386091 GGATTTCAAGATATGGATCTTGG - Intronic
1199894656 X:152118286-152118308 GGGACTCAGGAGACAGAGCTTGG - Intergenic