ID: 930013868

View in Genome Browser
Species Human (GRCh38)
Location 2:46957612-46957634
Sequence GGGACATGGGTCAGTGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930013860_930013868 9 Left 930013860 2:46957580-46957602 CCAGGGTCAAGGGGTGCTCTGGA 0: 1
1: 0
2: 0
3: 19
4: 200
Right 930013868 2:46957612-46957634 GGGACATGGGTCAGTGATGTAGG 0: 1
1: 0
2: 0
3: 18
4: 171
930013852_930013868 30 Left 930013852 2:46957559-46957581 CCTGGAGGAGCTCTTAGCCTTCC 0: 1
1: 0
2: 1
3: 9
4: 162
Right 930013868 2:46957612-46957634 GGGACATGGGTCAGTGATGTAGG 0: 1
1: 0
2: 0
3: 18
4: 171
930013858_930013868 13 Left 930013858 2:46957576-46957598 CCTTCCAGGGTCAAGGGGTGCTC 0: 1
1: 0
2: 8
3: 243
4: 6316
Right 930013868 2:46957612-46957634 GGGACATGGGTCAGTGATGTAGG 0: 1
1: 0
2: 0
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930013868 Original CRISPR GGGACATGGGTCAGTGATGT AGG Intronic
900734046 1:4283741-4283763 GGAACCTGGGTCAGAGAGGTGGG - Intergenic
902251799 1:15158487-15158509 GGGGCAAGGGGCAGTGATGGTGG - Intronic
905618717 1:39421420-39421442 GGGAAATGGGCCAGTAACGTTGG - Intronic
906532315 1:46530833-46530855 GGGACATGGATCAATGGTGTGGG - Intergenic
910756646 1:90700419-90700441 GGGAAAGGGGTCAGTAAAGTTGG + Intergenic
912964486 1:114226059-114226081 GGTTGATGGGCCAGTGATGTTGG - Intergenic
914813164 1:151044451-151044473 GACACATAGGTCAGTGATGAAGG - Intronic
919745493 1:201005972-201005994 GGGACACGGGTCCCAGATGTAGG + Intronic
919932114 1:202227903-202227925 GAGACAAGGGTCAGCGATGTTGG - Intronic
921813259 1:219538235-219538257 GGGAAAAGGGTCAGTCAAGTGGG + Intergenic
924783866 1:247176670-247176692 GGGTCCTGGGTCAGGGATATTGG - Intergenic
1063127136 10:3145216-3145238 TTGACATGGAACAGTGATGTCGG - Intronic
1063497386 10:6522698-6522720 GGGAGATGGCTCAGTGTTGGGGG + Intronic
1064973537 10:21090008-21090030 GGGACTTGGGGCAGAGATCTGGG - Intronic
1066035842 10:31482870-31482892 GGGACAAGAGTCAGAGATCTAGG - Intronic
1068544998 10:58335186-58335208 GCGCCATGGGTCAGGGATGGCGG - Exonic
1071887169 10:89963858-89963880 AGAAGATGGGTCAGAGATGTGGG + Intergenic
1074999463 10:118784442-118784464 GAGAAATGGGTCAGTGTAGTTGG - Intergenic
1075403076 10:122174846-122174868 GGGACATGGGGGAGAGATGTTGG - Intronic
1075903351 10:126061131-126061153 GGGTCATGGGCCAGATATGTTGG - Intronic
1075979925 10:126729348-126729370 AGGAAATGGGGCAGTGATGATGG - Intergenic
1077117928 11:893690-893712 GGGGCATGAGACAGTGTTGTTGG - Intronic
1080940956 11:36917274-36917296 GGGATAAGGGAAAGTGATGTTGG + Intergenic
1089581628 11:119485062-119485084 GGGACAGGGGTAAGGGGTGTGGG + Intergenic
1089690009 11:120181283-120181305 GGTACATGAGTGAGTGATCTGGG - Intronic
1089794500 11:120969416-120969438 GGGGCAGGAGTCAGTGCTGTGGG + Intronic
1090135746 11:124198057-124198079 GGGACATGGGTCAGGGAAAGGGG - Intergenic
1090226820 11:125076675-125076697 GGGACACGGGTCAGGGATGCCGG + Intronic
1202808002 11_KI270721v1_random:15131-15153 GGGACACGGAGCAGTGCTGTCGG - Intergenic
1094474106 12:30828082-30828104 GGGACACCGGTCAGTGCTGAGGG - Intergenic
1096098664 12:48955999-48956021 GGGACATGGGACAGTGTTATGGG - Intronic
1097280389 12:57842025-57842047 GGGACCAGGGTCAGGGATGGTGG - Intronic
1097286255 12:57879679-57879701 GGGATATGGGATATTGATGTGGG + Intergenic
1102635103 12:114316559-114316581 GGGGCAGGGGGCAGTGAAGTTGG - Intergenic
1106662436 13:31814262-31814284 GGGTCATGGGTGAATGATATGGG - Intergenic
1107078632 13:36350188-36350210 GGGACCTGGGTTAGTGGTTTTGG - Intronic
1109969745 13:69752627-69752649 GTGACATTGGTAAGTGCTGTAGG + Intronic
1110462135 13:75756905-75756927 GGGACATGAATCACTGAGGTGGG + Intronic
1111471701 13:88692122-88692144 GGGACATGTTGGAGTGATGTTGG - Intergenic
1111877900 13:93919423-93919445 AGGACATGGTTCACTAATGTGGG + Intronic
1112749265 13:102565804-102565826 GGGCTATGGGTCACTGATGTGGG - Intergenic
1113436731 13:110298508-110298530 GGAAAATGGGTCAGTGATGGGGG - Intronic
1113496392 13:110733220-110733242 GGGACCTGGGTGAGTCATGGGGG - Intergenic
1113533604 13:111046800-111046822 GGGTCATGTGCCAGGGATGTGGG - Intergenic
1114261829 14:21042579-21042601 GGGAAAGGGGAGAGTGATGTTGG + Intronic
1114513300 14:23280176-23280198 GAGACATGGGTCAGAGATTGGGG + Intronic
1121264041 14:92587554-92587576 GGGAAATGGGTTAGTATTGTGGG + Intronic
1126361415 15:47850276-47850298 GGGACATGGGCCAGTGGGATTGG - Intergenic
1127908834 15:63398829-63398851 GGGAAAAGGGACAGTGCTGTAGG - Intergenic
1128336442 15:66788796-66788818 GAGACCTGGGTAAGTGATGCTGG + Intergenic
1128747274 15:70123394-70123416 GGGACTTGCCTCAGGGATGTGGG + Intergenic
1129795660 15:78374297-78374319 GAGACATAGGTGGGTGATGTGGG + Intergenic
1132341246 15:101079624-101079646 AGGACCTGGGGCAGTGATGGGGG + Intergenic
1134839720 16:17392110-17392132 GGGAGATGGGGAAGTCATGTAGG - Intronic
1135344805 16:21679954-21679976 GGGACATGGGGCAGGGAACTAGG + Intronic
1136579638 16:31143536-31143558 GGGACATGGGAGAGTGAGTTGGG - Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1137585904 16:49664061-49664083 GAGGCATGGGACAGTGATGAGGG - Intronic
1137777444 16:51067888-51067910 GGGATCTGGGTCAGTGACATTGG - Intergenic
1147217256 17:38908149-38908171 GGGACAGGTGTCCTTGATGTTGG - Intronic
1149297851 17:55276682-55276704 GGGAGATGAGTCAGAGAGGTTGG + Intronic
1151567010 17:74904373-74904395 GCCCCATGGGGCAGTGATGTTGG + Intergenic
1151675727 17:75596434-75596456 GGGGCATGTGGCAGTGAGGTGGG - Intergenic
1155981967 18:32189474-32189496 GGGACATGGGTCATAAAAGTAGG - Intronic
1158029703 18:52948584-52948606 TGGACATCTATCAGTGATGTAGG - Intronic
1160195493 18:76751758-76751780 GTCACATGGGTCACTGAAGTGGG + Intergenic
1161607148 19:5221433-5221455 GGGTCAGGGTTCAGTGAGGTTGG - Intronic
1161825451 19:6560999-6561021 GGGACATGGGTAAGGGAGGTAGG + Intergenic
1163255373 19:16152983-16153005 GGGACTTGGGGCAGGGATGAGGG + Intronic
1164852738 19:31498274-31498296 GGGGCCTGGGGCACTGATGTTGG - Intergenic
1165362014 19:35342552-35342574 GGGAAAGGGGACAGTGAGGTGGG - Intronic
1166069984 19:40381350-40381372 GGAACTTGGGCCAGTGATTTGGG - Intronic
1166120679 19:40684560-40684582 GTGACACAGGACAGTGATGTGGG + Intronic
1166412704 19:42566949-42566971 GGGACATTGCTCAATGATGCAGG + Intergenic
1166804527 19:45477374-45477396 GGGACATGGGACAGAGAGGAGGG + Intronic
1167643482 19:50694425-50694447 GGGACAGGGGCCTGGGATGTAGG + Intronic
1167665733 19:50821998-50822020 GGGACATGGGCAAGGGGTGTTGG + Intronic
1167914907 19:52733013-52733035 AGGACGTGGGTCAGTGAAGTGGG - Intronic
1167921163 19:52784468-52784490 AGGAAGTGGGACAGTGATGTGGG - Intronic
1167988087 19:53335194-53335216 AGGAAATGGGGCAGTGAAGTGGG + Intronic
1168340720 19:55621717-55621739 GGGACATGGGTTAGTTAAGGCGG - Exonic
1168644769 19:58052917-58052939 GGAACAAGGGCCAGTGCTGTGGG + Intronic
926140930 2:10367676-10367698 GGGTCATGGGACTGTGATATGGG - Intronic
927635975 2:24817127-24817149 GAGTCATGGGTCAGTTATGGTGG + Intronic
928884395 2:36131588-36131610 GGGACAAGGGACAGGGATGTTGG - Intergenic
929545262 2:42851380-42851402 GGGATCTGGGTCAGGGGTGTTGG + Intergenic
930013868 2:46957612-46957634 GGGACATGGGTCAGTGATGTAGG + Intronic
930240097 2:48927446-48927468 GGAACATGGGACAGTGAACTAGG + Intergenic
930638265 2:53829251-53829273 GGGACATGGGCTAGTGGGGTGGG + Intergenic
933773137 2:85756159-85756181 GGGAAAGTGGTCAGTGAGGTGGG + Intronic
938135725 2:128755054-128755076 GGGCCGAGGGTCAGGGATGTGGG - Intergenic
938198508 2:129353887-129353909 GGGACCTGGGTCGGTGTTGGAGG + Intergenic
938291232 2:130151859-130151881 GGCACAGGGGTCCGCGATGTTGG + Exonic
938465309 2:131521100-131521122 GGCACAGGGGTCCGCGATGTTGG - Intergenic
939120289 2:138108567-138108589 GGGAGATGGGAGAGTGATGAAGG - Intergenic
941331705 2:164185677-164185699 GTCACCTGGATCAGTGATGTTGG - Intergenic
942121221 2:172779549-172779571 GGGAAATGGGTGACTGAGGTGGG + Intronic
945847894 2:214969087-214969109 GGTAGATGGGTCAGTTAAGTTGG - Intronic
946250183 2:218406712-218406734 GGGAAAGGGGTGAGTGAGGTGGG - Intergenic
946359620 2:219211215-219211237 AGGATATGGGGCAGTGATGGTGG - Intronic
947621835 2:231595785-231595807 GTGACATGGGTCACTGATGCAGG - Intergenic
948557580 2:238824223-238824245 TGGACATGGGTCCATGATGTAGG - Intergenic
948736622 2:240012136-240012158 GGGAGATGGGTGAGCGATGGAGG - Intronic
1168918520 20:1511599-1511621 GGGACATGGGACAATGCTGGAGG - Intergenic
1169902412 20:10566973-10566995 GGGAGATAGGCCAGTGATGGTGG - Intronic
1170732341 20:18985951-18985973 GGGATATAGGTCACTGATGGTGG - Intergenic
1172725236 20:37034933-37034955 GGGTAATGTGTCAGTAATGTAGG + Intronic
1173429548 20:42974088-42974110 GGGATATGGGTGGGTGATGGTGG - Intronic
1174839150 20:53885437-53885459 GTGACATGAGTCAGCCATGTGGG - Intergenic
1175634425 20:60568854-60568876 GGGACAGGGGCCCGGGATGTGGG - Intergenic
1175644969 20:60663392-60663414 GAGACTGTGGTCAGTGATGTGGG + Intergenic
1176232037 20:64037661-64037683 GTGAAAGGGGTGAGTGATGTCGG - Intronic
1178434641 21:32547333-32547355 GGGCCATGGTGCAGAGATGTAGG - Intergenic
1179382093 21:40909126-40909148 GGGAAATGGGAAAGTGATGGGGG - Intergenic
1183160431 22:36109678-36109700 GGGACGTGGGGCAGGGAAGTGGG - Intergenic
1183319794 22:37158059-37158081 GGGTCATGTGTCAGAGATGTTGG - Intronic
1184409065 22:44316202-44316224 GGGACCTGGGTCAAGGATGCAGG + Intergenic
951089853 3:18559992-18560014 GGGAGAGGGGTGTGTGATGTGGG - Intergenic
951481311 3:23165110-23165132 GGCACATCGGCCAGTGATGCTGG + Intergenic
965041459 3:163513076-163513098 GGGAAATGGTACAGTGATGTTGG + Intergenic
966948956 3:184798464-184798486 GGGAGTTGGGAAAGTGATGTAGG - Intergenic
968093214 3:195910402-195910424 GGGACATGGGTCTGTGGGCTGGG - Intronic
968728705 4:2259934-2259956 GGGACATGGCACAGTGAGGCTGG - Intronic
969513615 4:7633853-7633875 GGCACATGGGCCAGTGAGGATGG + Intronic
970264234 4:14263565-14263587 GAGAAATGGGTCATTGTTGTTGG + Intergenic
970566096 4:17334064-17334086 GGGAAATGGGGCAATGAGGTAGG - Intergenic
970965358 4:21921985-21922007 GTGAGATGAGTCAGTGAGGTAGG - Intronic
972253950 4:37333554-37333576 GGGACTTGGGTTTGTGATCTAGG - Intronic
974721014 4:65737845-65737867 GGCACATGAGTCCCTGATGTTGG - Intergenic
977345757 4:95814144-95814166 TGGGCATGGGTCAGTGATGAGGG + Intergenic
978636584 4:110815477-110815499 GGGACAGGGGTTAGAAATGTCGG + Intergenic
986285179 5:6353877-6353899 GGGACATGGGGCAGGGGGGTTGG + Intergenic
987417069 5:17673392-17673414 AGGACATGAGTTAGTGAAGTAGG - Intergenic
989094733 5:37771360-37771382 GGGACATGGGGCTGTGCTGAGGG + Intergenic
997242488 5:132318043-132318065 GGGACATGGGTCAAGGGAGTGGG + Intronic
997745965 5:136300661-136300683 GGGACACGGGTCAGCAATGAAGG + Intronic
998867238 5:146517743-146517765 GGGACAGTGGTCAGTGGTGCTGG + Intergenic
1001048548 5:168395220-168395242 TGGACATGGGTCTGTACTGTGGG - Intronic
1002431812 5:179208354-179208376 GGGACCTGGCCCAGAGATGTGGG - Intronic
1005139733 6:22614888-22614910 GGCACATGGGTTAATGAGGTAGG + Intergenic
1006644011 6:35503888-35503910 GGGGCCTGGGGCAGGGATGTAGG - Intronic
1006798151 6:36743864-36743886 GGGGCATGGGCCAGTGGTCTCGG - Intronic
1006886784 6:37388635-37388657 GGGATGTGGGGCAGGGATGTGGG + Intronic
1008124991 6:47658104-47658126 GTGACATGGGTTGGTGATATGGG + Intronic
1008447865 6:51614168-51614190 TGGGCATGTCTCAGTGATGTGGG + Intergenic
1010829862 6:80514936-80514958 GGAACATGGGTGAATGATGAAGG + Intergenic
1011030129 6:82913478-82913500 GGGTCATGGGTAAATGAAGTAGG - Intronic
1014931819 6:127344843-127344865 GTGAAATGGCTCAGTGATCTTGG - Intergenic
1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG + Exonic
1016629956 6:146217160-146217182 GAGCCATAGGTCAGTGAGGTAGG + Intronic
1018329555 6:162712565-162712587 GAGACATGGGTCAGAGATTAAGG - Intronic
1019417238 7:933459-933481 GGGGCAGGGGTCAGTGGTGCTGG + Intronic
1019417285 7:933586-933608 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417295 7:933616-933638 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417338 7:933736-933758 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417348 7:933766-933788 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417379 7:933856-933878 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417389 7:933886-933908 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417410 7:933946-933968 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417442 7:934036-934058 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417452 7:934066-934088 GGGACTGGGGTCAGTGGTGCTGG + Intronic
1019417481 7:934156-934178 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417513 7:934246-934268 GGGACCGGGGTCAGTGGTGCTGG + Intronic
1019417523 7:934276-934298 GGGACTGGGGTCAGTGGTGCTGG + Intronic
1020498402 7:8886058-8886080 GGGACATGGTTAGGTAATGTTGG + Intergenic
1024134097 7:46389122-46389144 GGGACACAGGTCTGTGATGTTGG + Intergenic
1029444361 7:100604331-100604353 GGAAAATGGGTCAGGGAGGTAGG - Intronic
1030711603 7:112756679-112756701 GGGACTTGGGTCAGAAATGTTGG + Intergenic
1032473356 7:132194239-132194261 GGGACCTGGGTAGGTGCTGTGGG - Intronic
1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG + Intergenic
1035908437 8:3539056-3539078 GAGACGTGGCTCAGTGATGGAGG - Intronic
1038199712 8:25400749-25400771 TGGACTTTGGTCAATGATGTGGG - Intronic
1038267290 8:26046948-26046970 GGGACTGGGGTCATTGATTTGGG + Intergenic
1039430468 8:37521492-37521514 GGGACATGATTCAGCGCTGTGGG - Intergenic
1052859928 9:33431320-33431342 GGGGCATGGGAAGGTGATGTGGG + Intergenic
1056957198 9:91091896-91091918 GGGACAGTGGACAGGGATGTTGG + Intergenic
1057874451 9:98743277-98743299 GGGAGGTGGGTGAGTGATGGTGG - Intronic
1057930059 9:99185346-99185368 GAGAGAGGGGTCACTGATGTGGG + Intergenic
1058120833 9:101136823-101136845 TGGACAGGGGTGAGAGATGTGGG + Intronic
1059680431 9:116580392-116580414 GGGCCATGGGTCCTTGATGTGGG - Intronic
1060252625 9:121998203-121998225 GGGACATAGGACTGTGGTGTGGG - Intronic
1060428412 9:123526092-123526114 GGGAGAAGGGTCAGTGGTATGGG - Intronic
1060493687 9:124102647-124102669 GGGACAAGGGGCAGGGATGCAGG - Intergenic
1061536568 9:131253984-131254006 GGGGCCTGGCTTAGTGATGTGGG - Intergenic
1062560353 9:137138941-137138963 GGGACAGGGGCCTGTGCTGTCGG - Intronic
1186873749 X:13797315-13797337 GGGATATGGGGGAGTGAGGTAGG + Intronic
1187269288 X:17765248-17765270 GGGGCATGGATCCCTGATGTGGG - Intergenic
1188981656 X:36732328-36732350 GGTACATGGCTAAATGATGTAGG - Intergenic
1189953858 X:46258841-46258863 GGGGTATGGATCAGTTATGTCGG + Intergenic
1192359330 X:70429167-70429189 GGACCATGGGTAAGGGATGTAGG + Intronic