ID: 930016947

View in Genome Browser
Species Human (GRCh38)
Location 2:46977240-46977262
Sequence TATCTAAGTTGAGGGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930016938_930016947 17 Left 930016938 2:46977200-46977222 CCTGGTAGCAGTGGGCAGACAAA 0: 1
1: 0
2: 1
3: 4
4: 133
Right 930016947 2:46977240-46977262 TATCTAAGTTGAGGGAGGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930016947 Original CRISPR TATCTAAGTTGAGGGAGGGC AGG Intronic
900393325 1:2443266-2443288 CATCTTAGTTGGGGGAGGGGTGG + Intronic
901737014 1:11319167-11319189 GATGTAAGTTGCAGGAGGGCGGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902661904 1:17910076-17910098 TATCTATATGGAGGGAGGGGAGG + Intergenic
902806248 1:18863105-18863127 GACCTGAGTTGAGGGAGGGCAGG - Intronic
906346747 1:45020296-45020318 TATCTGATTGGTGGGAGGGCTGG - Intronic
908120067 1:60978022-60978044 TATCTAATTTGAGCCAGGGCTGG - Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911557294 1:99360486-99360508 TCTATAAGTAGAGGGAGGTCAGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912708663 1:111933911-111933933 TATCTAGGTTGGGGAAGGGTTGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
917707538 1:177649332-177649354 AATCCAACTTGAGGGAGGGGAGG + Intergenic
923120389 1:230984638-230984660 TATCTAGGTTTAGGAAGGGGAGG + Intronic
1066459284 10:35599000-35599022 GATGTAAGTTCAGTGAGGGCAGG + Intergenic
1068725730 10:60300505-60300527 TATTTAAATGGAGGGTGGGCGGG + Intronic
1070988714 10:80712241-80712263 ATTGTAAGTTGAGGGAGGGCAGG + Intergenic
1071052351 10:81466524-81466546 TATATTAGTTGGGGGAGGGTGGG - Intergenic
1073108817 10:101048654-101048676 GAACTGAATTGAGGGAGGGCGGG - Intergenic
1073214380 10:101828568-101828590 TCTCTAGGCTGAGGGAGGGAGGG - Intronic
1073556086 10:104453141-104453163 TATTTAAGGTGAGAGAGGGCAGG + Intronic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1074850364 10:117434541-117434563 CATCAGAGTTGAGTGAGGGCTGG + Intergenic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1076620988 10:131788027-131788049 TATCTGATTTGAGGGGTGGCAGG + Intergenic
1076731944 10:132443737-132443759 GAGCTCAGCTGAGGGAGGGCGGG + Intergenic
1079820934 11:25127395-25127417 TGTCTAAGTGAAGGGATGGCTGG + Intergenic
1080195960 11:29609225-29609247 AATGTAAGTTCAGTGAGGGCAGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083955210 11:65979046-65979068 TATGAAGGTTGAGGCAGGGCCGG - Exonic
1083990908 11:66245161-66245183 TCTCTAAGTCAAGGGCGGGCAGG - Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1089521328 11:119066267-119066289 GAAATAAGTTGGGGGAGGGCCGG + Intergenic
1091542529 12:1474999-1475021 ACTCTGAGTTCAGGGAGGGCTGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1095958805 12:47820842-47820864 TTTATTAGCTGAGGGAGGGCTGG - Intronic
1096519071 12:52173988-52174010 TATCTGAGTGGAGGGCAGGCTGG + Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098536920 12:71603564-71603586 TATCTAATTTGGGGGTGGGGAGG - Intergenic
1099504254 12:83453155-83453177 CATTCAAGTTGATGGAGGGCTGG - Intergenic
1103744953 12:123116170-123116192 TCTCTAAGCTTAGGGAGGCCTGG + Intronic
1104608183 12:130205120-130205142 CACCTAAGTTTATGGAGGGCGGG + Intergenic
1107489925 13:40871924-40871946 TATCTATGTATAGAGAGGGCAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108789035 13:53943922-53943944 TATATTGGTTAAGGGAGGGCTGG - Intergenic
1112304976 13:98265613-98265635 TATATAAATTCAGGAAGGGCTGG - Intronic
1112909298 13:104462129-104462151 TATGAAAGTTGATGGAGGTCGGG - Intergenic
1116039310 14:39666610-39666632 CAGCTCAGCTGAGGGAGGGCTGG - Intergenic
1116189574 14:41646929-41646951 TATCTAAATTGAGGCAAGGATGG + Intronic
1116960674 14:50965302-50965324 CCTCTTAGCTGAGGGAGGGCAGG - Intergenic
1119161246 14:72453979-72454001 TATCTAAGTGCAGGGGAGGCTGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120268967 14:82286252-82286274 TTATTAAGTTTAGGGAGGGCAGG - Intergenic
1120380603 14:83774281-83774303 TAGCTAATTTGTGGTAGGGCTGG + Intergenic
1124384874 15:29198527-29198549 TATCTAATTTGGGGGTGGGTGGG + Intronic
1127885831 15:63199875-63199897 TATCAAAGTTGAAGGCTGGCCGG - Intronic
1129116389 15:73367688-73367710 TATCAAAGTGGAGGGAGGCGCGG - Exonic
1131492857 15:92877984-92878006 TATTTAAGTTGAGGCAGGAAGGG - Intergenic
1133236070 16:4387996-4388018 TGTCCAAGGTGAGGGAGGCCAGG + Exonic
1134911159 16:18027864-18027886 AATGTAAGCTCAGGGAGGGCAGG - Intergenic
1134978632 16:18590105-18590127 GAGCTAAGGTGAGGGAGGGAGGG - Intergenic
1137250299 16:46736389-46736411 TGTCTGAGGTGAGGAAGGGCAGG + Intronic
1141231806 16:82174557-82174579 TGTCTCAGCTAAGGGAGGGCAGG + Intergenic
1141823711 16:86464824-86464846 TATCTAAAATGATGGAAGGCAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145765243 17:27454659-27454681 TTTATAAGTTGAGTGAGGACTGG + Intergenic
1150752159 17:67874234-67874256 TGTCTAAGTTGAAAGAGGGTAGG + Intronic
1151468260 17:74301680-74301702 TATCAAAGTTCAGGTCGGGCAGG + Intronic
1152061858 17:78082248-78082270 TTACTAAGTTTAGTGAGGGCAGG + Intronic
1158012329 18:52743258-52743280 TCTCTAAGTAGAGAGAGGGATGG - Intronic
1158013691 18:52759199-52759221 TATTTAAGTTGAGGGTGTGGGGG - Intronic
1158133227 18:54176168-54176190 TGGCTAAGTAGAGGGAGGACAGG + Intronic
1158172994 18:54620267-54620289 TAGCTAAGAACAGGGAGGGCAGG + Intergenic
1158557612 18:58488267-58488289 AATCTTTGTTGAGTGAGGGCAGG - Intronic
1160523563 18:79522628-79522650 TATCTGAGGTGAGGGAAGGCTGG - Intronic
1161645477 19:5450954-5450976 GGGCTAAGATGAGGGAGGGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1166155338 19:40907528-40907550 TAACTTATTTGAGAGAGGGCAGG + Intergenic
1166779976 19:45336874-45336896 TATGTGTGTTGGGGGAGGGCAGG - Intronic
1167009359 19:46796573-46796595 TCTCTAAGAAGCGGGAGGGCAGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
930016947 2:46977240-46977262 TATCTAAGTTGAGGGAGGGCAGG + Intronic
930575716 2:53145117-53145139 AATGTAAGTTCTGGGAGGGCAGG - Intergenic
934544867 2:95206449-95206471 TATCTAGGTTTAGGAAGGGGAGG + Intergenic
935454614 2:103252791-103252813 TTTCTAATTTGAGGTGGGGCAGG + Intergenic
937619938 2:123973640-123973662 TCTGTAAGTTGCGGGAGGGGTGG + Intergenic
939033888 2:137108454-137108476 TTTCTAAATTGAGGGAGGAAAGG - Intronic
941449578 2:165643643-165643665 AATATAAGTTGAATGAGGGCAGG - Intronic
943528667 2:189051277-189051299 TATCTCAGTTGAAGGTGGTCTGG + Intronic
943621683 2:190155254-190155276 TGCCTAAGTTAAGGGAGGGTAGG + Intronic
945700793 2:213168886-213168908 TATCTAAGGAGAGGTGGGGCAGG + Intergenic
947399526 2:229717271-229717293 CATCTAACTTTAAGGAGGGCAGG - Intergenic
947455149 2:230247391-230247413 TGTTTAAGTTGAGGGAGGTGGGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168954531 20:1825860-1825882 TAGCTTTGTAGAGGGAGGGCAGG + Intergenic
1170670649 20:18429658-18429680 TATCTCAGAAGAAGGAGGGCAGG - Intronic
1171333781 20:24364530-24364552 TAGCTTTGTTGAGGGAGGGAGGG + Intergenic
1172124389 20:32616623-32616645 AACATAAGTTCAGGGAGGGCAGG + Intergenic
1176916139 21:14627461-14627483 TATCTAAATTGAGGCAAGGATGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1185035240 22:48472333-48472355 TATATAAGGTCAGGGAGGGAAGG - Intergenic
950453674 3:13079879-13079901 TATGTAAGATGAGGGAAGGAGGG + Intergenic
950819832 3:15744758-15744780 TATCTAAGTGGTGGGATTGCTGG + Intronic
954923711 3:54214050-54214072 TATCTTAGTTGCTGGAGGTCAGG + Intronic
956839158 3:73121084-73121106 TGTAAAAGTTGAGGCAGGGCTGG + Intergenic
958066315 3:88548481-88548503 TATCTAAGTTAAGACAGGCCTGG - Intergenic
960992532 3:123321396-123321418 TATCAGAGTTGAGGGTGGGAAGG + Intronic
961705663 3:128783255-128783277 CATCTAAGTGGGGGTAGGGCAGG - Intronic
963450063 3:145467621-145467643 TATCTATCTTGAGGGAGGTATGG - Intergenic
964479334 3:157126540-157126562 AATCTAAGTTGAGTGACAGCAGG + Intergenic
965414597 3:168377071-168377093 TATCTAATTTCAAGGATGGCAGG + Intergenic
965475352 3:169149041-169149063 TGGGCAAGTTGAGGGAGGGCAGG - Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
968207725 3:196819144-196819166 TTTTTAAGATGAGGGAGGCCGGG + Intronic
969081298 4:4620644-4620666 TGTCTAAGTTGAGAGAGTTCTGG - Intergenic
969565754 4:7976640-7976662 TGTGTAAGATGAGGGATGGCAGG - Intronic
970270286 4:14339335-14339357 TGTATGAGTTGGGGGAGGGCAGG + Intergenic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
973871743 4:55173324-55173346 TGTGTGAGTTGAGGAAGGGCTGG - Intergenic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
978455436 4:108884607-108884629 TATCTAAGGTGAGGGAATACTGG - Intronic
979355489 4:119698669-119698691 TATCCAAGATGAGAGAGGGAAGG + Intergenic
979505010 4:121485569-121485591 GATCTATGTTGAGGGAGGGTGGG + Intergenic
981881237 4:149615324-149615346 TATCTAAGGTGAGTGAGACCTGG - Intergenic
983420526 4:167509679-167509701 TATCTGAGTTGAGACAGGGTAGG - Intergenic
984183023 4:176508465-176508487 CATTTAAATTGAGGCAGGGCTGG - Intergenic
985353342 4:189090669-189090691 CAGCTAAGGTGAGGGAGGCCAGG + Intergenic
986327341 5:6686091-6686113 TAGCAAAGGTGAGGCAGGGCAGG + Intergenic
986562437 5:9075649-9075671 TATCTGAGATGAGGGAGTACTGG + Intronic
993901413 5:93585949-93585971 TATTTAAAATGGGGGAGGGCTGG + Intronic
998005446 5:138653971-138653993 CATCTAATTTGGGGGAGGGTGGG + Intronic
998765946 5:145487520-145487542 TATATAACTTGAGGAAGGGTTGG + Intronic
998788370 5:145737768-145737790 GATGTAACTTCAGGGAGGGCAGG + Intronic
999288282 5:150407094-150407116 TCTCTGAGTTGAGGGATGGTGGG + Intronic
999384335 5:151143669-151143691 TTTCGAAGTTCCGGGAGGGCAGG + Intronic
1000397608 5:160792114-160792136 TATGAAAGTTTAGGGAGGGGGGG - Intronic
1003142337 6:3481878-3481900 TATGGAAGTTGAGGTGGGGCCGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004494291 6:16149221-16149243 TAACCAAGTTGATGGAGGGATGG + Intergenic
1004515741 6:16321041-16321063 CATCTAAGTTGAAGCAGGGAAGG + Intronic
1004761788 6:18675186-18675208 TATCTCAGCTGGGGTAGGGCAGG - Intergenic
1005353832 6:24962903-24962925 TATCTTTGTTGATGGAGGCCAGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1008269195 6:49469541-49469563 TTTGTAATTTGTGGGAGGGCAGG + Intronic
1011669960 6:89674027-89674049 TATCTAAATTGGGGGTGGGAAGG - Intronic
1011743435 6:90386407-90386429 TGTGTCAGTTGAGGGAGGACTGG - Intergenic
1012004440 6:93694892-93694914 TATGTAATTTGGGGGAAGGCAGG - Intergenic
1012267465 6:97163359-97163381 TAACTCAGATGAGGGAGTGCAGG + Intronic
1020480470 7:8654047-8654069 AATCTATTTTCAGGGAGGGCTGG + Intronic
1022781275 7:33586889-33586911 AATGTAAGATCAGGGAGGGCAGG + Intronic
1023754931 7:43407654-43407676 TGTCCATGGTGAGGGAGGGCGGG - Exonic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1027460363 7:78444733-78444755 CATATAAATTGAGGGAGAGCCGG - Intronic
1028327513 7:89545298-89545320 TTACTAAGTTTAGTGAGGGCGGG + Intergenic
1029630624 7:101747978-101748000 TATCTCAGTTTGGGGAGGTCTGG + Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034621861 7:152463266-152463288 TGGCTGAGTTTAGGGAGGGCGGG + Intergenic
1035489399 7:159259749-159259771 ATTATAGGTTGAGGGAGGGCAGG - Intergenic
1037005009 8:13767483-13767505 TATTTAAGTTTAGCGAGGGCAGG + Intergenic
1037520022 8:19671598-19671620 AATATAAGTTGCGGGAGGGCAGG - Intronic
1037589103 8:20298356-20298378 TTTGAAAGTTGAAGGAGGGCTGG - Intronic
1039626232 8:39057688-39057710 TCTCTTACTTGAGGGAGGACTGG + Intronic
1041066810 8:54090578-54090600 TTACTAAGTTTAGTGAGGGCGGG - Intronic
1041084465 8:54243995-54244017 GATTTAAGTTGAGAGAGGGCTGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044669482 8:94664417-94664439 TATCAAAGCTGAGGAAGGCCAGG - Intronic
1047451164 8:124966268-124966290 TTACTAAGTTTAGTGAGGGCGGG - Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1057856243 9:98602983-98603005 TATCTAGCTGTAGGGAGGGCCGG + Intronic
1059096091 9:111416403-111416425 TTTTTGAGTTGAGGAAGGGCAGG - Intronic
1059306457 9:113356953-113356975 TATATGAGTTGGGAGAGGGCTGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1188196692 X:27243199-27243221 TATCTAGGCTGAGGGTGGGTGGG - Intergenic
1189346476 X:40245573-40245595 TCTTTCACTTGAGGGAGGGCAGG + Intergenic
1191856687 X:65632991-65633013 TAGCTAAGCAAAGGGAGGGCTGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic