ID: 930019889

View in Genome Browser
Species Human (GRCh38)
Location 2:46995145-46995167
Sequence CTTCCTCGATGTTGTCCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930019889_930019898 21 Left 930019889 2:46995145-46995167 CCCCAAGGACAACATCGAGGAAG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 930019898 2:46995189-46995211 GCGAATCCATGGTAAGCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 43
930019889_930019896 10 Left 930019889 2:46995145-46995167 CCCCAAGGACAACATCGAGGAAG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 930019896 2:46995178-46995200 CCTCCTCATCAGCGAATCCATGG 0: 1
1: 0
2: 3
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930019889 Original CRISPR CTTCCTCGATGTTGTCCTTG GGG (reversed) Exonic
901482629 1:9536270-9536292 CTTACTCAATGTTGTGCTAGAGG - Intergenic
902892939 1:19457887-19457909 CTTCCCTGATGTTGCCCTTTAGG - Intronic
903631995 1:24781606-24781628 CTTCCCCACTGATGTCCTTGAGG - Intronic
910446347 1:87302170-87302192 CTTGCTGGATGTTGTCCTGAGGG + Intergenic
913045373 1:115069372-115069394 CATCCTCGAACTTGTCATTGTGG - Intronic
918995400 1:191752441-191752463 TTTCCTCTATGCTGTTCTTGTGG + Intergenic
919845619 1:201640341-201640363 CTTCCTGGATGAGGTCCTGGAGG + Intronic
921389070 1:214601402-214601424 CTACCTCGATATTCTGCTTGTGG - Intergenic
921406693 1:214788144-214788166 CCTCCTCCATGATGTCTTTGAGG - Intergenic
923324092 1:232865339-232865361 CGTGCTTGTTGTTGTCCTTGTGG - Intergenic
923747705 1:236717902-236717924 CTTCCTCGATGTTCTCAATCTGG - Exonic
1067475524 10:46563336-46563358 CTTCCTTGATCTGGTCTTTGTGG - Intergenic
1067619212 10:47778439-47778461 CTTCCTTGATCTGGTCTTTGTGG + Intergenic
1067799720 10:49350685-49350707 CCTCCTCCATGCTGTCCCTGAGG - Intergenic
1069307150 10:66985087-66985109 CTTCCTAGATATTTTCCTTATGG + Intronic
1073372377 10:103002160-103002182 CTTCCTTGATGGTATCCTTTAGG - Intronic
1073903250 10:108246985-108247007 CTTCCTGGATCTTGTTTTTGTGG + Intergenic
1074983661 10:118639413-118639435 CTTCCTCCCTGTAGTTCTTGGGG + Intergenic
1076049192 10:127319080-127319102 CTTCTCCTTTGTTGTCCTTGGGG - Intronic
1077634424 11:3832497-3832519 GTTCCTTGATGCTGCCCTTGAGG - Intronic
1082746789 11:56971637-56971659 CATTCTAGATGTTGTCTTTGTGG + Intergenic
1084042654 11:66551283-66551305 CTTCCTCGATGTTCTCGATCTGG - Exonic
1091683450 12:2543463-2543485 CTTCCTAGAAGTTTTCCTTGAGG + Intronic
1091753619 12:3037973-3037995 CATCCTCGATGTTGGTGTTGAGG - Exonic
1091774439 12:3175264-3175286 CTTCCTCGGCCTTGACCTTGAGG + Intronic
1094234757 12:28151029-28151051 CTTCCTCCATTGTGTCCTTTTGG + Intronic
1096089544 12:48889774-48889796 CTTTCTTGTTGGTGTCCTTGAGG + Intergenic
1097053508 12:56237313-56237335 CTTCCTCTATGTGGCCCTTGTGG + Exonic
1098476325 12:70908541-70908563 CTTCCTCTATCCTGTTCTTGTGG - Intronic
1101335929 12:103796923-103796945 CATAGTCGATGTTGTTCTTGAGG + Exonic
1101863295 12:108500154-108500176 CTTTCCCAGTGTTGTCCTTGGGG - Intergenic
1103025998 12:117574569-117574591 TTTCCTGCATGCTGTCCTTGTGG - Intronic
1107013477 13:35690610-35690632 CTTCTTCCATGTTGTACCTGAGG + Intergenic
1108885202 13:55171925-55171947 AATCCTAGAAGTTGTCCTTGTGG - Intergenic
1114413077 14:22518646-22518668 CTTCCTCTGTATTGTCCTTATGG - Intergenic
1116702737 14:48260945-48260967 TTTCCTCTATGTTCTCCTTCTGG - Intergenic
1120131234 14:80809981-80810003 TGTCCTTGTTGTTGTCCTTGTGG - Intronic
1120707786 14:87762143-87762165 TTTCCCCCATGCTGTCCTTGTGG + Intergenic
1122836565 14:104433638-104433660 CTTCCTCGGTGATGTCCTGTGGG + Intergenic
1124210015 15:27755159-27755181 CTTTCTACATTTTGTCCTTGGGG + Exonic
1126299821 15:47183643-47183665 CTTCCTCGCTGTTATTGTTGTGG - Intergenic
1128506052 15:68273638-68273660 CTTCCTTGATTTTGCCCCTGAGG - Intergenic
1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG + Intronic
1136383910 16:29911076-29911098 CTTCCTCAAGGATGTCCTGGGGG - Exonic
1137013234 16:35344710-35344732 CTTCCTCCAAATTGACCTTGGGG + Intergenic
1137759843 16:50931666-50931688 CTTCCTTGCTGCTGTCATTGAGG - Intergenic
1139338009 16:66246741-66246763 TTTCATCTATATTGTCCTTGTGG + Intergenic
1143881383 17:10032618-10032640 CTGCCTTGATATTTTCCTTGTGG - Intronic
1146436594 17:32855153-32855175 TTTCCTCCATGATTTCCTTGAGG + Intronic
1148819585 17:50352903-50352925 CTTCCTCGAGGCTGTGCTGGAGG + Intronic
1148858180 17:50590593-50590615 CATCTTCGATGGTGTCATTGTGG + Exonic
1150925563 17:69528389-69528411 CTTCCTGTCTGTTTTCCTTGAGG + Intronic
1152114310 17:78375660-78375682 ATTCCTTGATGTTATCCTTAGGG + Intergenic
1156092406 18:33487561-33487583 CTCCCTGGATGTTGCTCTTGGGG + Intergenic
1159171878 18:64780919-64780941 CTTCCTCACTGCTGTTCTTGTGG + Intergenic
1160978535 19:1806096-1806118 CTGGGACGATGTTGTCCTTGCGG + Exonic
1162597415 19:11639977-11639999 CCTCCTCGCTGTTGTCTCTGGGG + Intergenic
1163458390 19:17422206-17422228 CATCCCCAATGTTGTCCATGTGG + Intronic
1164735244 19:30536303-30536325 CTTCCTCCAGGTGGTCCCTGGGG + Intronic
1165769017 19:38367723-38367745 CGTCCTCACTGTAGTCCTTGAGG - Exonic
928374555 2:30764251-30764273 CTTCCTCGAGGATGCCCTGGTGG - Exonic
929856577 2:45643093-45643115 CTAGCTCGCTGTTGTCCTAGTGG + Intergenic
930019889 2:46995145-46995167 CTTCCTCGATGTTGTCCTTGGGG - Exonic
936738506 2:115475480-115475502 CTTCCTGGAGGTTCTCCATGAGG - Intronic
937868454 2:126771078-126771100 CTTCCTTGATGTTTTCTCTGGGG - Intergenic
941343552 2:164338383-164338405 CTTCCTCTCTGGTGTCCTAGGGG + Intergenic
942223236 2:173791593-173791615 TTTCCTCCTTGTTGTGCTTGGGG + Intergenic
943847838 2:192674533-192674555 CTTCCACTCTGGTGTCCTTGAGG + Intergenic
945271734 2:207947494-207947516 CTGCCAGGATTTTGTCCTTGGGG - Intronic
1169645013 20:7800847-7800869 CTTCATCACTGTTGTGCTTGTGG - Intergenic
1172313217 20:33933823-33933845 CTTCCTCTATCCTGTCTTTGTGG - Intergenic
1175652736 20:60740726-60740748 CTTCTTTGATGGTGTCCTTGAGG + Intergenic
1178516171 21:33249372-33249394 GTTCCTTGATGTTGTGCATGTGG - Intronic
1181093295 22:20489046-20489068 CCTCTTCGATGTTGTGCTGGTGG - Exonic
1181114509 22:20622789-20622811 CAGCCTGGATGGTGTCCTTGTGG - Intergenic
1182156728 22:28080780-28080802 TTTCCTCTATGTTTTCCTTTAGG + Intronic
1183279921 22:36926523-36926545 TTTCCTGGATGTGGCCCTTGAGG + Intronic
1185135120 22:49065914-49065936 CGTCCTCCATGTCCTCCTTGTGG - Intergenic
950569060 3:13788791-13788813 TTTCCTGGATTTTGTCCTTGGGG + Intergenic
951127391 3:18999811-18999833 CTTCCACGCTGTTGGCATTGGGG - Intergenic
958167460 3:89895462-89895484 CTACCTTGAGGTTTTCCTTGTGG - Intergenic
959351383 3:105269016-105269038 TTTCCTCCATGCTGTTCTTGTGG + Intergenic
960447597 3:117766658-117766680 CTTCCCCCATGTTGTTCTTATGG + Intergenic
961713464 3:128844129-128844151 CTTCCTCGATGTGGCCTTGGTGG + Intergenic
967521137 3:190434330-190434352 TTTCCTCCATATTGTTCTTGTGG + Intronic
967964068 3:194946724-194946746 CTTCATTGACTTTGTCCTTGAGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969977384 4:11117436-11117458 TTCCCTGGATGTTCTCCTTGTGG + Intergenic
970244876 4:14050439-14050461 CTTCCTCCATGTTTTACTTTGGG - Intergenic
970452605 4:16185801-16185823 CTGGCTTGATGATGTCCTTGAGG - Intronic
972241954 4:37203271-37203293 TTTCCTCCATATTGTTCTTGTGG - Intergenic
972523206 4:39881893-39881915 TTTCCTCCATATTGTTCTTGTGG + Intronic
973804587 4:54513586-54513608 CTTCCTCGTCGTTGTCCTTTGGG - Intergenic
976702489 4:87986264-87986286 CTTCCTCAATTATTTCCTTGTGG - Intergenic
976785404 4:88814104-88814126 CTTCCTCCATGATGTCTTTGAGG - Intronic
977582888 4:98744620-98744642 CTCCCTTGATTTTTTCCTTGGGG + Intergenic
981914312 4:150016826-150016848 CTTCCTCCATACTGTTCTTGTGG - Intergenic
987065852 5:14288879-14288901 CCCCCTCCATGTTTTCCTTGAGG + Intronic
987161507 5:15148959-15148981 TTGCCTCTATGTTGACCTTGTGG - Intergenic
989465311 5:41747978-41748000 CTTCTTCCATGTTGTCCTTTAGG + Intronic
990094422 5:52094351-52094373 TTTCCTCCATGCTGTTCTTGTGG + Intergenic
990245417 5:53859282-53859304 CTTCCTCGAAGTCTTCCTTCTGG - Intergenic
993989670 5:94640580-94640602 CTTCCTTCATGTTGTTCTTCTGG + Intronic
998743254 5:145228929-145228951 CTTCCTCGAAGTCTTCCTTCTGG - Intergenic
1005360238 6:25024343-25024365 CTTCCTCGAAGTCTTCCTTCTGG + Intronic
1006013578 6:31062642-31062664 ATTGCTCTAAGTTGTCCTTGAGG - Intergenic
1006662310 6:35657755-35657777 CTTCCTCCATTTTGTACTTAGGG + Intronic
1012192655 6:96299762-96299784 CTTCCTTGATTCTTTCCTTGTGG + Intergenic
1014902990 6:126990605-126990627 CTTCATTGATGTTGTGCTTTGGG - Intergenic
1015464660 6:133535319-133535341 CCTTCTCGGTTTTGTCCTTGGGG - Intergenic
1017426948 6:154331835-154331857 CTCCCTTGATTTTTTCCTTGGGG - Intronic
1018154242 6:160970757-160970779 TTTCCCCCATGTTGTTCTTGTGG - Intergenic
1021491204 7:21221290-21221312 CTTCCTCGAAGTCTTCCTTCTGG + Intergenic
1021973386 7:25986690-25986712 CTTCCTGGAGGTTGTGCTTCTGG - Intergenic
1024133867 7:46386928-46386950 ATTCCTCGATCTTCTCCTGGTGG + Intergenic
1028104456 7:86860687-86860709 CTTCCATGATGATGTCCATGGGG + Intronic
1029051338 7:97692088-97692110 CTTCCTGTATATTGTTCTTGTGG - Intergenic
1029700250 7:102241800-102241822 AATCCTGGATTTTGTCCTTGCGG - Intronic
1029726307 7:102407857-102407879 CCTCCTCGATCTTGTCCAGGAGG + Intronic
1033071836 7:138209943-138209965 TTTCCTCCATGCTGTTCTTGTGG - Intergenic
1038545480 8:28422958-28422980 TTTCCTGGATGTGGACCTTGTGG + Intronic
1040079854 8:43275214-43275236 CTTCCTTGCTGCTCTCCTTGGGG + Intergenic
1040397856 8:47016572-47016594 CTTCCTCGGTGTTCTGTTTGAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1049311145 8:141934592-141934614 TGTCCTAGATGCTGTCCTTGTGG - Intergenic
1052436754 9:28439537-28439559 CTTCCTCCTTGCTGTTCTTGTGG + Intronic
1052798484 9:32946112-32946134 CTTCCTCGAAGTCTTCCTTCTGG - Intergenic
1055626008 9:78178378-78178400 CTTCCTCGAAGTCTTCCTTCTGG - Intergenic
1056135832 9:83628734-83628756 CCTCCTGGGGGTTGTCCTTGGGG + Intronic
1057845354 9:98518511-98518533 CTTCCTCCATGAAGTCCTTCTGG + Intronic
1060648924 9:125307427-125307449 TTTCCTTGATGTTGTGATTGGGG + Exonic
1061417350 9:130454316-130454338 CTTCCTCGAAGTCTTCCTTCTGG - Exonic
1061897993 9:133658467-133658489 CCTCCTCCATGCTGTCCCTGTGG + Exonic
1186156074 X:6728197-6728219 TTTCCTCCATGTTGTTCTTGTGG - Intergenic
1197796833 X:130306766-130306788 TTTCCTTGATATTGTCTTTGAGG + Intergenic
1200380578 X:155833424-155833446 TTTCCTCTATACTGTCCTTGTGG + Intergenic
1201754892 Y:17476363-17476385 CTTCCTTGATAATGTCATTGAGG + Intergenic
1201784351 Y:17757774-17757796 TTTTCTCTCTGTTGTCCTTGGGG + Intergenic
1201817202 Y:18148213-18148235 TTTTCTCTCTGTTGTCCTTGGGG - Intergenic
1201846660 Y:18429622-18429644 CTTCCTTGATAATGTCATTGAGG - Intergenic