ID: 930020797

View in Genome Browser
Species Human (GRCh38)
Location 2:47000977-47000999
Sequence CTGGAGGCACAGAAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 548}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930020785_930020797 30 Left 930020785 2:47000924-47000946 CCCAGGGTCTCTTATGGCACGGA 0: 1
1: 0
2: 0
3: 3
4: 47
Right 930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG 0: 1
1: 0
2: 4
3: 65
4: 548
930020786_930020797 29 Left 930020786 2:47000925-47000947 CCAGGGTCTCTTATGGCACGGAT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG 0: 1
1: 0
2: 4
3: 65
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930020797 Original CRISPR CTGGAGGCACAGAAGGAGCC AGG Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900181844 1:1314579-1314601 CATGAGAGACAGAAGGAGCCTGG + Intronic
900204500 1:1426285-1426307 CAGGAGGTGCAGCAGGAGCCCGG - Exonic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
900809042 1:4787314-4787336 CTGGGGGCAGAGAAGGAGAGAGG + Exonic
900851217 1:5144596-5144618 AGGGAGGAACAGGAGGAGCCCGG - Intergenic
901037664 1:6346056-6346078 CTGGAAGCAGAGAGGGAGCCAGG + Intronic
902681575 1:18047592-18047614 CAGGAGGCTCGGAGGGAGCCAGG + Intergenic
902922711 1:19676612-19676634 CTGGAGGCCTAGAAAGAGCCGGG + Intronic
903343904 1:22672482-22672504 CTGGTGGCATGGAAGGGGCCTGG - Intergenic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
903689732 1:25164250-25164272 CTCCAGGAGCAGAAGGAGCCTGG - Intergenic
904132949 1:28288842-28288864 TTGTAGGGACAGAAGGAGCTGGG + Intergenic
904756362 1:32770795-32770817 CTGGTGGCTCAGAAGGGGCGGGG + Exonic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906520853 1:46466247-46466269 CTGGACACACAGAAGGCGCTGGG + Intergenic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907440735 1:54476626-54476648 TGGGAGGGACAGAAGGAGGCAGG - Intergenic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
911192575 1:94962504-94962526 CTGAAGGTACTGCAGGAGCCAGG - Intergenic
912812735 1:112806180-112806202 CTGGACCAACAGAAGCAGCCGGG + Intergenic
913182493 1:116335649-116335671 CTGGTAGCACAGAAGCATCCTGG + Intergenic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
913714402 1:121519388-121519410 CTGGAGGAGGAGAAGCAGCCGGG - Intergenic
914846483 1:151286587-151286609 CTGGAGGCTCAGCAGGAGACGGG + Exonic
915477466 1:156161323-156161345 CTGGGGGCACAGGGGGAGTCAGG - Intronic
915645100 1:157264876-157264898 CTGGAGGAAGTGAGGGAGCCTGG + Intergenic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917186210 1:172359048-172359070 CTGGTGGCTCAGACGGGGCCTGG + Intronic
918052545 1:180987109-180987131 CTGGAGGCAGAGAACAAACCAGG - Intronic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
919802882 1:201364233-201364255 CTGGGGGCCCAGCAGGAGCTGGG + Intronic
919829768 1:201532094-201532116 CTGGGGGCACTGAAAGGGCCAGG + Intergenic
919921999 1:202171594-202171616 CTGGAGGCCTCCAAGGAGCCCGG + Intergenic
920194364 1:204217060-204217082 CTGGAGGCATAGAAGTGGCAGGG + Intergenic
920234589 1:204494433-204494455 CTGGAGCCGCAGAGCGAGCCCGG - Intronic
920751383 1:208680739-208680761 ATGGAGGCACAGAATGTTCCTGG - Intergenic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
922414045 1:225403928-225403950 CTGGAGGTACTGGTGGAGCCAGG - Intronic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
922899120 1:229122771-229122793 CTGCAGTCAAAGCAGGAGCCAGG + Intergenic
923022395 1:230175035-230175057 CTAGAGACACAGCAGGGGCCAGG - Intronic
923687024 1:236160528-236160550 GTGGACAGACAGAAGGAGCCTGG - Intronic
924036666 1:239944798-239944820 TTGGAGGCTCAGAAGAAGACAGG - Intergenic
924088099 1:240475012-240475034 CTGGAGGGACTGAAGGGGACAGG - Exonic
924378013 1:243433497-243433519 CTGGAGGCATGGCAGCAGCCAGG - Intronic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1062971671 10:1653492-1653514 CTGCAGGCACACAAGGCGTCGGG - Intronic
1062971689 10:1653603-1653625 CTGCAGGCACAGAAGGCGTTGGG - Intronic
1062971695 10:1653640-1653662 CTGCAGGCACAGAAGGTGTTGGG - Intronic
1063199717 10:3776182-3776204 GTGGAGGCACAGAAGTGGCAGGG + Exonic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063767525 10:9159834-9159856 TTGGAGGCTCAGAAGAAGACAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1064328519 10:14372817-14372839 TTGGGGGCACAGAAGGATCCTGG - Intronic
1064711489 10:18130792-18130814 GTGGAGGCAAAGAATGATCCAGG + Intergenic
1066039758 10:31536630-31536652 CTGGTGGAAGAGAAGGAGACAGG + Intergenic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066489702 10:35882857-35882879 CTGGAGGGACAGATGCAGACAGG + Intergenic
1067080689 10:43210746-43210768 ATGTAGGCACAGACGGGGCCGGG + Intronic
1067286638 10:44912046-44912068 CTGGAGGGACAGGCTGAGCCTGG + Intronic
1067797472 10:49331280-49331302 CTGGAGCCCCAAAAGTAGCCTGG - Intergenic
1067847562 10:49736125-49736147 CAGGAGGCAGAGAAGTACCCAGG - Exonic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1068900957 10:62268733-62268755 CCGGGGGCGCAGGAGGAGCCGGG + Intergenic
1069097558 10:64278050-64278072 CATGTGACACAGAAGGAGCCAGG - Intergenic
1069486596 10:68827678-68827700 CTGGAGGCGCAGAAGGCGGCGGG + Exonic
1069486683 10:68828014-68828036 CTGGAGGCGCAGAAGGCGGCGGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070521303 10:77255945-77255967 CCTGATGCAAAGAAGGAGCCTGG + Intronic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1071480532 10:86061669-86061691 CAGGAGGGACAGAAGCAGGCTGG - Intronic
1071532556 10:86400923-86400945 CTGGAGGCAGAGAGAGCGCCTGG + Intergenic
1072078038 10:91998573-91998595 CTTGAAACACAGAAAGAGCCAGG + Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1073330906 10:102669372-102669394 TTGGAGGCACAGAGCAAGCCTGG - Intergenic
1074311530 10:112327110-112327132 CAGGAAGCAAAGATGGAGCCAGG + Intergenic
1074613691 10:115044891-115044913 CTGGAGGCCCAGGAACAGCCTGG - Intergenic
1074710329 10:116172153-116172175 CTGGAGGACGAGCAGGAGCCAGG + Intronic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1075948487 10:126457724-126457746 GTGGAGGCACTGAAGGCCCCAGG + Intronic
1076218347 10:128713394-128713416 CTGGATGCAGACAAGGAGACAGG - Intergenic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076648926 10:131973826-131973848 CTGGACGCACAGCATGAGTCTGG - Exonic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076704511 10:132293856-132293878 CCGGGGACGCAGAAGGAGCCAGG + Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076867994 10:133178648-133178670 CAGGAGGCACAGAGGCAGCCAGG - Intronic
1076922615 10:133462658-133462680 CTGAAGGCACTAAGGGAGCCCGG - Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077393871 11:2311818-2311840 CTGGGGGCTCTGAAGGAGCCTGG - Intronic
1077466932 11:2737929-2737951 CTGGGGGCACAGAATGACACTGG + Intronic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1081048702 11:38310546-38310568 CTAGAGCCTCAGAAGGAGCGTGG + Intergenic
1081136423 11:39445140-39445162 CTGGAGGCACATGAGGACACTGG + Intergenic
1083327310 11:61879366-61879388 CAGGAGGTAGATAAGGAGCCAGG + Exonic
1083633927 11:64109866-64109888 CGGAAGGCACAGCAGGAGCAGGG + Intronic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1084042271 11:66549080-66549102 CCGGAGGGGCAGCAGGAGCCAGG - Intronic
1084360313 11:68664816-68664838 CTGGCAGGACAGAAGCAGCCAGG + Intergenic
1084445991 11:69204121-69204143 ACTGAGGCCCAGAAGGAGCCAGG + Intergenic
1085127824 11:74013803-74013825 CCAGAGGCACAGAAAGAGTCAGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1087269146 11:96093222-96093244 AAGGAGGTAAAGAAGGAGCCAGG - Exonic
1088686477 11:112288457-112288479 CTGGAGGCCAAGAAGGAGCTGGG + Intergenic
1088831285 11:113539102-113539124 GAGGGGGCACAGAAGCAGCCTGG + Intergenic
1089644889 11:119872402-119872424 CTGGAGGGCAGGAAGGAGCCAGG - Intergenic
1089668544 11:120035726-120035748 CCAGGGACACAGAAGGAGCCAGG - Intergenic
1089846638 11:121463999-121464021 CTGTGAGGACAGAAGGAGCCAGG - Intronic
1092203738 12:6603232-6603254 CTGGAGGCACACACAAAGCCTGG + Intronic
1092770207 12:11889886-11889908 GTGCAGGCACAGAAGGGGACTGG + Intronic
1094101319 12:26767148-26767170 CTCCAGGCTCAGAAGGAGGCCGG - Intronic
1094499903 12:31012090-31012112 CTGGCGGGACAGACAGAGCCAGG + Intergenic
1095928545 12:47603704-47603726 CTGGTGGCACAAAAGCTGCCAGG - Intergenic
1097686508 12:62695965-62695987 ATCCAGGCACAGGAGGAGCCTGG + Intronic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1098610631 12:72453096-72453118 TTGGAGGCTCAGAAGAAGACAGG + Intronic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1102705409 12:114876172-114876194 CCTGAGGCAGAGATGGAGCCGGG + Intergenic
1103219816 12:119234378-119234400 CTGGAGGCAGAGAAAGAGGCCGG - Intergenic
1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG + Intronic
1104593563 12:130104082-130104104 CAGGAGGACCCGAAGGAGCCAGG - Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104710567 12:130982839-130982861 CTGGGGACACAGAAGGACTCAGG + Intronic
1104768763 12:131346833-131346855 CTGGAGGTGCAGAACGAGGCTGG + Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105303110 13:19152530-19152552 CAGGAGGCACAGGCTGAGCCTGG + Intergenic
1106022303 13:25926992-25927014 CGGGAGGCACAGCAGGATGCAGG - Intronic
1106456803 13:29934981-29935003 CTGCAGGCTCAGAAAGAGGCAGG + Intergenic
1107432516 13:40352614-40352636 CTGGTGACAAAGCAGGAGCCTGG - Intergenic
1107877707 13:44805274-44805296 ATGGAGGAAAAGAAGGAGCTAGG - Intergenic
1108642465 13:52395525-52395547 CTGGAGGCAGGGAACGAGCAGGG + Intronic
1109009574 13:56923132-56923154 TGGGAGGCAAAGGAGGAGCCAGG + Intergenic
1109349669 13:61161994-61162016 CTACAGGCACAGAAGGTTCCTGG + Intergenic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114455102 14:22848979-22849001 CTGGAGCCAGTGGAGGAGCCTGG + Intronic
1114989107 14:28264695-28264717 CTGGACGCACAGCATGAGTCTGG + Intergenic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1118915002 14:70095413-70095435 ACTGAGGCACAGAAGGAACCTGG - Intronic
1119040760 14:71272225-71272247 GAGGAGCCACAGAAGGAACCTGG - Intergenic
1119310145 14:73639343-73639365 TTGGAGGTACAGAAGGTGGCAGG - Intergenic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1121260149 14:92559924-92559946 CTGGGAGCACAGAGTGAGCCTGG + Intronic
1121310102 14:92931322-92931344 GTGAAGCCACAGACGGAGCCAGG + Exonic
1121325637 14:93018134-93018156 CTGGAGGCACAGCAGAAGATGGG + Intronic
1121489808 14:94349709-94349731 CTGGAGGAACAGAACCTGCCGGG + Intergenic
1121511364 14:94515435-94515457 CTAGAGGCAGTGAAGGAGCAGGG + Intronic
1121908124 14:97766080-97766102 CTGGATTGACAGAAGAAGCCAGG - Intergenic
1122316353 14:100827984-100828006 CTGGGGGCGCAGGAGGCGCCTGG + Intergenic
1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG + Intergenic
1122905172 14:104798256-104798278 CTGGCGGGACAGAGAGAGCCTGG - Intergenic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1122938832 14:104972186-104972208 GGGGAGGCCCAGAAGGGGCCTGG - Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1123406254 15:20020907-20020929 CTGGAGGCTCTGAGGGAGACGGG + Intergenic
1123515584 15:21027555-21027577 CTGGAGGCTCTGAGGGAGACGGG + Intergenic
1125430675 15:39590030-39590052 CTGGAGGCACACAAAGGACCTGG - Intronic
1126957522 15:53950720-53950742 CTGAAGACACAGAAATAGCCAGG + Intergenic
1127332502 15:57952663-57952685 TTAGAGGAACAGAAGGAGCATGG - Intergenic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1128223717 15:65987012-65987034 CTCGAGGAACAGAACAAGCCGGG - Intronic
1128342131 15:66830038-66830060 CTGGAGGCAGACAAGGCTCCAGG + Intergenic
1128731663 15:70025539-70025561 CTGGAGGCACCGAAGGGACTGGG + Intergenic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1128780920 15:70358155-70358177 CAGGAGACACTGAAGGAGACTGG + Intergenic
1128786917 15:70404354-70404376 CCTGAGGCACAGATGGATCCAGG - Intergenic
1128861980 15:71081833-71081855 CTAGTGGCACAGGAGGAGCATGG + Intergenic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129701214 15:77769589-77769611 CTGGAGGCAAGGATGGAGGCAGG + Intronic
1129779215 15:78258984-78259006 CTGGAGGTTGAGAAGGAGCCAGG - Intergenic
1130294041 15:82630710-82630732 CTGGAGGGACAGAATGTGCCTGG + Intronic
1130708901 15:86260137-86260159 TTGGAGGCACAGCAAGAGCAAGG + Intronic
1131095651 15:89652902-89652924 CTGGAGGCTCAGAGGCTGCCAGG - Exonic
1131274679 15:90971134-90971156 CTGGGGGCAAACTAGGAGCCAGG + Intronic
1131534029 15:93219299-93219321 CAGGAGGAACAGAAGGGCCCAGG - Intergenic
1132005873 15:98226465-98226487 CTGGAGGGAAAGAATGGGCCCGG + Intergenic
1132608690 16:804415-804437 CTGGAAGGACAGAAGCAGGCTGG + Intergenic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133003018 16:2860614-2860636 CGGGAGGCAGAGAGGGAGGCTGG - Intergenic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1136141655 16:28292593-28292615 CTGGAGCCGCAGCCGGAGCCCGG + Exonic
1137672575 16:50287944-50287966 CTGGATGCACAGGAGGATGCTGG + Exonic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1139354164 16:66357396-66357418 GGGGAGGCACAGAGGGATCCGGG - Intergenic
1139558541 16:67727734-67727756 CTGCAGGTACAGGATGAGCCGGG - Exonic
1139563486 16:67758382-67758404 CAGGAGGCTCAAAAGGAGCTCGG - Intronic
1139581977 16:67879186-67879208 GTGGAGGCACAGAGAGGGCCAGG + Intronic
1139611114 16:68059462-68059484 GTGGAAGGACAGATGGAGCCAGG + Intronic
1139640686 16:68289404-68289426 CTGGAGGCTCAGGAGCATCCTGG + Intronic
1141664566 16:85459224-85459246 GTGGAGACACAGAGGGTGCCTGG - Intergenic
1141717180 16:85733759-85733781 CTGGAGTCTCAGAGGAAGCCAGG + Intronic
1142112192 16:88338862-88338884 CTGGAGCCTCAGGAGGAGCGTGG + Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143001209 17:3796420-3796442 TTGGAGTCACTGAAGGACCCTGG + Intronic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1143253040 17:5536941-5536963 CTGAAAGCACAAAGGGAGCCGGG + Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1143880551 17:10026514-10026536 CTGGACACCCAGAAGCAGCCAGG + Intronic
1144202228 17:12952021-12952043 CGGGGGCCACAGGAGGAGCCAGG + Intronic
1144586586 17:16491459-16491481 CCGCAGGCAGAGAAGGAGGCTGG - Intronic
1144742205 17:17590313-17590335 CAGGAGGCACAGGAGGAGATGGG - Intronic
1144787909 17:17842074-17842096 CTGGGGGCACATAATGAGCCAGG + Intergenic
1146704716 17:34992612-34992634 CAGGAGGTGGAGAAGGAGCCGGG + Exonic
1147037778 17:37694523-37694545 TTGGAGGAACAGAAGAAGACAGG + Intronic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1147454880 17:40530940-40530962 CTGAAGGCTCAGTAGGAGTCAGG + Intergenic
1147599016 17:41734392-41734414 CTGGAGCCAAGGCAGGAGCCCGG - Exonic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148239726 17:45992362-45992384 CTGGAGACAGAGCAGCAGCCTGG + Intronic
1149745609 17:59094853-59094875 CTGGAGGCAGAGAAAAGGCCAGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151393451 17:73803419-73803441 CAAGAGGCACAGGAGTAGCCTGG - Intergenic
1151529409 17:74695065-74695087 CTGGGGTCCAAGAAGGAGCCTGG + Exonic
1152254217 17:79228014-79228036 CTGCAGGGTCAGAAGGACCCAGG + Intronic
1152341541 17:79728570-79728592 CGGGGTGCACAGAAGGGGCCTGG - Intergenic
1152774760 17:82194096-82194118 CTGGAGGCTCTGAAGGAAGCCGG - Exonic
1152890654 17:82879941-82879963 CTGGAGACACCCAAGGAGACAGG - Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153590962 18:6673861-6673883 TCGGGGTCACAGAAGGAGCCTGG + Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155128501 18:22904420-22904442 CTTGAGACACAGAAGAAGACTGG + Intronic
1155571434 18:27198013-27198035 CTGGAGGCAGAGAATGAGTGAGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1156924858 18:42563921-42563943 CTGGAGACACATAATCAGCCAGG + Intergenic
1157429788 18:47615266-47615288 CCTGAGGCACAGAGGGAGCAAGG + Intergenic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1159681149 18:71354207-71354229 CTGGAGGCTCAGCAGGAGAGTGG - Intergenic
1160065864 18:75573793-75573815 CTGCAGGCACAGAAAGTTCCGGG - Intergenic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160803776 19:982621-982643 CTGGAGGCACAGCAGGTCCTTGG + Intergenic
1160870888 19:1277345-1277367 CTGGAGACTCAGCAGGACCCTGG + Intronic
1161266093 19:3365513-3365535 CTGGGGGCTCAGACGGAGGCAGG + Intronic
1161302225 19:3548201-3548223 CTGCAGGTGCAGCAGGAGCCAGG + Exonic
1161332378 19:3694481-3694503 CTGGAGGCAGACGAGGGGCCTGG - Intronic
1161515211 19:4692625-4692647 CTGGGGGCACTGCAGCAGCCTGG + Intronic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161953604 19:7480951-7480973 TTGGAGGCACAGAACTAGTCAGG + Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163408991 19:17141637-17141659 CTTGAGGCAGGGAAGGTGCCTGG - Intronic
1163626068 19:18390477-18390499 CTGGAGGAAGAAAAGGAGTCGGG + Intergenic
1163801431 19:19368083-19368105 CTGAAGGCTCAGAAAGTGCCTGG + Intergenic
1164419442 19:28075773-28075795 GTGGAGGGACAGAAGCAGTCAGG + Intergenic
1164420561 19:28088177-28088199 GTGGAGCCACAGAAGCAGACAGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1166036319 19:40170757-40170779 CTAGAGGCATAGAAGGGGCCAGG - Intergenic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166388880 19:42397765-42397787 TTGGAGGAGCAGAAGGTGCCAGG + Intergenic
1166939079 19:46352063-46352085 CTGGAGCCACTCATGGAGCCTGG + Intronic
1167052966 19:47090883-47090905 CTGGAGGCAGGGAAGGGGGCAGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167252985 19:48410781-48410803 GGGGAGGCACAGAAGAAGACAGG + Intronic
1167448941 19:49556075-49556097 CTGGAGGCAGGGAAGGGGCGGGG + Intronic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1167924921 19:52813583-52813605 CTGGAGGGACAGGAGCAGGCAGG - Intronic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168344770 19:55644776-55644798 GAGGAGTCACAGAGGGAGCCAGG + Exonic
925977283 2:9150141-9150163 CTGGAGGCCAAGAAGGGGGCTGG + Intergenic
926225013 2:10961249-10961271 CTGGAGGAGCAGAACGAGCCCGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139152 2:20118075-20118097 CTGGAGGAGCAGGGGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927490143 2:23515884-23515906 TAGTGGGCACAGAAGGAGCCTGG + Intronic
927516438 2:23674526-23674548 CTGGAGGGATTGAAGAAGCCAGG - Intronic
928756636 2:34534191-34534213 GTGGAGGCACAGTAGGAGTTGGG - Intergenic
928952626 2:36826510-36826532 CTAGAGGAAAAGAAGGAGCAGGG - Intergenic
929464182 2:42129891-42129913 CATGAGGGACAGAAGGAGGCAGG + Intergenic
930002232 2:46869222-46869244 CAGGAGGCACACAGGGAGCTTGG - Intergenic
930019710 2:46994182-46994204 TTGGAGGGACTGAAGGAGCAAGG + Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
930620398 2:53637612-53637634 CTTGTGGCACAGAAGGAGTTTGG - Intronic
931103736 2:59031553-59031575 CTGGAGGCACAGAAATACACAGG + Intergenic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
933781870 2:85808067-85808089 CTGGTAGCACAGAAGGCTCCTGG + Intergenic
934165385 2:89289637-89289659 CTGGAGCCTCTGAAGGAGCCTGG - Intergenic
934201889 2:89892825-89892847 CTGGAGCCTCTGAAGGAGCCTGG + Intergenic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
935692525 2:105744623-105744645 CTGGAGGCGCAGCACGGGCCGGG - Intergenic
935702571 2:105825093-105825115 CTGGAGGGAGAGGAGGAGGCAGG - Intronic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
936046676 2:109193959-109193981 CTGGTGCCCCAGAAGGAGCATGG - Intronic
937909061 2:127066595-127066617 CTGGAGGTAGAGGAGGAACCAGG - Intronic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
939113487 2:138034319-138034341 CTTGAGGCAAGGAAGGAGACTGG - Intergenic
940286579 2:152038549-152038571 CTGGAGGCACAGAAGAGGAAAGG + Intronic
941394791 2:164961210-164961232 CAGGAGGCAAAGCAGGAGCAAGG + Intergenic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
942195958 2:173520330-173520352 GTGTAGCCTCAGAAGGAGCCAGG + Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
943789730 2:191918569-191918591 TTGGGAGCCCAGAAGGAGCCGGG + Intergenic
944168678 2:196750809-196750831 CTGGTGGCCCAGACTGAGCCAGG - Intronic
945058651 2:205889528-205889550 CTGGAGGCACAGGAAGGGCAGGG + Intergenic
946417543 2:219547954-219547976 GTGGGGGCACAGGAGCAGCCCGG - Exonic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946486407 2:220104898-220104920 ATGGTGGCAGGGAAGGAGCCAGG - Intergenic
946916397 2:224527207-224527229 CTGAAAGCAGAGAAGGTGCCAGG + Intronic
948893894 2:240919423-240919445 TTGGAGGCAGAGCAGGGGCCTGG - Intronic
949041507 2:241851967-241851989 CTGCAGGGACAATAGGAGCCAGG - Exonic
1168834098 20:865700-865722 GTGGAGGGTCAGAAGGGGCCTGG - Intergenic
1168965104 20:1894277-1894299 CTGGAGGCGGCGAAGGAGTCGGG - Exonic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1169200211 20:3705613-3705635 CTGGAGGCCCAGGAGCAGCCTGG + Intronic
1170038694 20:12017717-12017739 CTGGAGGCCAAGCAGGTGCCTGG + Intergenic
1170889129 20:20364448-20364470 CGGGAGGCCCGGAAGGTGCCTGG + Intergenic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171084093 20:22219958-22219980 CTGGAGAAAGATAAGGAGCCAGG - Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172009504 20:31838151-31838173 CTGAGGGCACACAAGGAGCAGGG + Intergenic
1172167267 20:32907013-32907035 CCTGAGGAACAGAAGGAGTCAGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172631601 20:36382116-36382138 CTGGAGGTGGAGAAGCAGCCTGG + Intronic
1172764243 20:37342697-37342719 GTGGAGGGACAGCAGGAGGCAGG + Intergenic
1172846236 20:37931364-37931386 CTGGAGCCACACCAGCAGCCGGG - Intronic
1173018030 20:39244481-39244503 CTGGAAGCACAGAAGGAGTCAGG - Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1173747702 20:45450328-45450350 CTGGTGGCACCGAAGGAGTCAGG + Intergenic
1174029593 20:47611820-47611842 CTGGAGGGGCAGAAGGAGTGGGG - Intronic
1174412207 20:50343565-50343587 CAGGAGGCTCTGAAGGAGGCAGG + Intergenic
1174737455 20:52978232-52978254 GTGGGGGCACAGACTGAGCCTGG + Intronic
1175131455 20:56792748-56792770 CTGGAGGCAAGGAAGGAGCCAGG + Intergenic
1175222458 20:57425331-57425353 CTGGAGGGTCAGGAGGGGCCAGG + Intergenic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175948985 20:62572382-62572404 CTTGAGGCACAGAGCAAGCCTGG - Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1179110849 21:38443843-38443865 CTGGAGTTACAGAAGGACCTGGG - Intronic
1179884328 21:44306997-44307019 CTGGGGGCAGGGAAGGAGCTGGG + Intronic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1179984604 21:44913561-44913583 CTGGGGGCACAAGAGAAGCCAGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181031570 22:20150741-20150763 CTGGCTGGACAGAAAGAGCCCGG + Exonic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181318198 22:21984847-21984869 CTGGAGGGAGAGGAGGAGCTCGG - Intergenic
1181397610 22:22633062-22633084 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1181453464 22:23039008-23039030 CAGCAGGCACTGAGGGAGCCTGG - Intergenic
1181500358 22:23312432-23312454 CTGGGGGCCCAGAATGAACCTGG + Intronic
1181544233 22:23592014-23592036 GCGTAGCCACAGAAGGAGCCTGG - Intergenic
1181614094 22:24040154-24040176 CTGGAGGGACAGAGGTAGCTGGG + Intronic
1181651796 22:24262996-24263018 CTGGGGGCCCAGAATGAACCTGG - Intergenic
1181705580 22:24647743-24647765 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1181907415 22:26210322-26210344 CTGGGGGCAGAGAAGGAAACAGG - Intronic
1182469931 22:30542324-30542346 CTGGAGGCGGCGAAGGAGTCGGG - Intronic
1182551329 22:31102384-31102406 ATAGAGGCCCAGAAGGAGCAAGG + Intronic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
1183461563 22:37953983-37954005 CTGGAGGCACAGGAGGGCCCAGG + Intronic
1183698734 22:39437931-39437953 CTGCCAGCACAGGAGGAGCCTGG - Intergenic
1184083216 22:42240639-42240661 GTGGAGGCCCAGAAAGTGCCTGG + Intronic
1184121257 22:42451927-42451949 CTGGAGGCACAAAACGGGCAAGG + Intergenic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184477331 22:44728827-44728849 CTGGAGGCTGAGAAGGGGCAGGG - Intronic
1184969468 22:48004906-48004928 CTGGTGGGAGTGAAGGAGCCCGG + Intergenic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1185331681 22:50254853-50254875 AGGCTGGCACAGAAGGAGCCGGG - Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
949944747 3:9180978-9181000 CTGGAGACACGGAGGCAGCCGGG + Intronic
950312908 3:11974763-11974785 CTGACGGCACAGAAGCAGACCGG - Intergenic
950493299 3:13319111-13319133 CTGCAGGCACAGCAAGATCCCGG + Exonic
950941373 3:16896369-16896391 CTGAAAGCACAAAAGGAGCTGGG + Intronic
951420116 3:22473981-22474003 ATGGAGACATTGAAGGAGCCTGG + Intergenic
952867470 3:37863417-37863439 CTAGAGGCACAGAAAGTTCCAGG - Intronic
953031718 3:39184176-39184198 CTGGAGCTACAGACGGGGCCAGG - Exonic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954462981 3:50638246-50638268 GAGGAGGCAAAGAAGGAACCCGG + Intronic
954493495 3:50930598-50930620 CTGGAGCCACCAAGGGAGCCTGG - Intronic
954993268 3:54859462-54859484 TTTGAGGCAAAGAAGGAGCTTGG + Intronic
955317597 3:57951799-57951821 CTGGAGGGGCAGAGGCAGCCTGG - Intergenic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
955531750 3:59880301-59880323 CTGGATGAAGGGAAGGAGCCAGG - Intronic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
956663720 3:71622918-71622940 ATGGAGGCAGAGATGGAGCCAGG + Intergenic
956733111 3:72214764-72214786 CTGGAGCCACTGAAGCAACCTGG + Intergenic
958268525 3:91469247-91469269 CTAGAGTCACAGACAGAGCCTGG + Intergenic
960133313 3:114080621-114080643 CTGGAGGTAGAAAAGGAGCTAGG + Intronic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
961944797 3:130674480-130674502 TGGCAGGCACAGAAAGAGCCTGG - Intronic
962412351 3:135152381-135152403 CTGGGGGTACAGCAGGAGCTTGG + Intronic
962432033 3:135328840-135328862 GCAGATGCACAGAAGGAGCCTGG + Intergenic
964489214 3:157216947-157216969 CTGGTGGCCAAGAAGGAGGCAGG + Intergenic
964604166 3:158541215-158541237 CTGAAGACTTAGAAGGAGCCAGG - Intronic
966191352 3:177274326-177274348 GGGGAAGCAGAGAAGGAGCCTGG - Intergenic
966309129 3:178574331-178574353 CTGAAGCCCCAGGAGGAGCCAGG - Intronic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
968577393 4:1374292-1374314 CAGGAGGCACAGGAGGTGCCAGG - Intronic
968628180 4:1637417-1637439 CTCGAGGGACAGAGGGAGCCTGG + Intronic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
968880472 4:3296135-3296157 ATGGAGGCAGGGCAGGAGCCGGG - Intronic
969366297 4:6696356-6696378 CTGAAGTCACACAGGGAGCCGGG - Intronic
969433639 4:7171164-7171186 GGGGAGGGACAGAAGGAGACGGG - Intergenic
969600185 4:8171503-8171525 CTTGAGGCAGGGAAGGAGCAGGG + Intergenic
970709024 4:18840544-18840566 ATAGAGGCACAAAAGAAGCCTGG - Intergenic
971267121 4:25105580-25105602 CAGGAGGCAGACAAGGAGCCGGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
974620532 4:64347968-64347990 CTAGAGGCTCAGAAGAAGACAGG - Intronic
976344901 4:83989549-83989571 ATGTAGGAAAAGAAGGAGCCAGG - Intergenic
977223762 4:94370381-94370403 CTGGAGGCTCTGAATGAGGCAGG + Intergenic
977262207 4:94811318-94811340 CTGAAGGCAAAGAAAGAGCAGGG + Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
981176955 4:141692810-141692832 TTGGAGGCTCAGAAGAAGACAGG - Intronic
981745566 4:148049329-148049351 CTGGAGGCAGGCAAGGAGCAGGG - Intronic
982231122 4:153209123-153209145 CTGAAGGCACGTAAGGAGCAGGG + Intronic
982812552 4:159844277-159844299 TTGGAGGAAAAGCAGGAGCCTGG - Intergenic
983556514 4:169063919-169063941 GTGGCAGCTCAGAAGGAGCCAGG - Intergenic
983557445 4:169071056-169071078 AGCGAGGCACAGAAAGAGCCAGG - Intergenic
985717014 5:1468346-1468368 CTGGAGCCTCAGAACGGGCCGGG + Intronic
985726298 5:1517523-1517545 CTGCAGGCACAGGAGGCACCGGG + Intronic
985781558 5:1874333-1874355 CAGAAGGCAGAGAAGCAGCCAGG - Intergenic
985894024 5:2738730-2738752 CCGGAGGCACAGGAGGAGGGAGG - Intergenic
985897691 5:2758817-2758839 CTGGAGGCAAAGGACAAGCCTGG + Intergenic
986892067 5:12320900-12320922 CTGGAAGCAAGGAAGGAGTCGGG + Intergenic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988083372 5:26441630-26441652 ATAGAGTCACAGAAAGAGCCTGG + Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
991159268 5:63477761-63477783 CTGGAGGGACAGAATGAGTTTGG + Intergenic
991425817 5:66490624-66490646 CTGGACACACAACAGGAGCCTGG - Intergenic
992195644 5:74336438-74336460 CAGGAGGCACCGAAGCAGGCAGG - Intergenic
992617795 5:78562036-78562058 AAAGAGGCACAGAAAGAGCCTGG + Intronic
993054558 5:82967536-82967558 ATGGAGGCACAGAAGCAAGCTGG + Intergenic
995196343 5:109373346-109373368 CTAGAGGCACAGAATGAGAGGGG + Intronic
995280894 5:110334431-110334453 CTGTAGGTAGAGAAGTAGCCTGG - Intronic
997250588 5:132385904-132385926 TTGGTGGTGCAGAAGGAGCCTGG - Intronic
998007816 5:138668709-138668731 CTGAAGGCACGGGAGGGGCCGGG - Intronic
998260932 5:140631568-140631590 CTGCGGGGATAGAAGGAGCCAGG - Intergenic
998373147 5:141673770-141673792 CTGGAGGCACGGGAGGATGCTGG - Exonic
998379602 5:141714737-141714759 CTCTAGGCAAAGGAGGAGCCAGG - Intergenic
999244261 5:150144894-150144916 TTGGAGGCCCAGATGGGGCCGGG - Intronic
999473232 5:151874762-151874784 CTGAAGGGTGAGAAGGAGCCAGG + Intronic
1001044529 5:168361648-168361670 CTGGAGCCACCCAAGGACCCAGG - Intronic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001636125 5:173211551-173211573 CTGGAGGCTGAGAAGGGGCCGGG + Intergenic
1001859804 5:175044139-175044161 CTGGAGGCCCAGTAAGAGACTGG - Intergenic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002382220 5:178839142-178839164 CTGGAGGCCCTGAAGTAGCAAGG + Intergenic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1002470377 5:179431436-179431458 CTGGAGCCACAGCATCAGCCAGG - Intergenic
1002787528 6:414977-414999 GTGGAGGCTCAGAAGAAGACAGG + Intergenic
1002841707 6:912070-912092 CAGGATGCAAAGCAGGAGCCCGG - Intergenic
1003192078 6:3883116-3883138 CAGGAGGCACAGAAGGCACAGGG - Intergenic
1003703280 6:8494619-8494641 CTGGAGTCACAGAATGTGTCTGG - Intergenic
1004513916 6:16306018-16306040 CTAGCGGCACAGAAGCAGCCGGG - Exonic
1005812587 6:29528815-29528837 CTGGAGGCTCAAAATGAGCAGGG - Intergenic
1005994313 6:30922260-30922282 CTGGAGTCACAGAAAGCGGCAGG - Intronic
1006117423 6:31782578-31782600 CTGGTGGCGCTGAAGGAGCGGGG - Exonic
1006145848 6:31959169-31959191 CTGGAGCCACAGCAGCTGCCTGG - Exonic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006370173 6:33639426-33639448 GAGGAGGTACAGAAGGAGCACGG + Intronic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006813322 6:36834957-36834979 CTGGAGCCAGAGAGGCAGCCCGG - Intronic
1007085883 6:39144920-39144942 GTGGTGGAAGAGAAGGAGCCAGG - Intergenic
1007665147 6:43509436-43509458 GTGGAGGAACAGGAGGTGCCAGG + Intronic
1008232029 6:48994897-48994919 CTAGAGGCACAGAAGGTGTTTGG + Intergenic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1008960498 6:57261270-57261292 CTTAAGGGACAAAAGGAGCCAGG + Intergenic
1008986679 6:57552334-57552356 CTAGAGTCACAGACAGAGCCTGG - Intronic
1009174640 6:60444901-60444923 CTAGAGTCACAGACAGAGCCTGG - Intergenic
1010454096 6:76035132-76035154 CTAGGGGCACTGAAGGAGCAGGG + Intronic
1014069429 6:117163992-117164014 CTGTTGGCAGAGAAGGAGGCAGG - Intergenic
1015614810 6:135063663-135063685 TTGGAGGCAGAGAAGGAGAAAGG + Intronic
1015714748 6:136180917-136180939 GTGGAGCTACAGAAGGAGCCAGG + Intronic
1016497758 6:144683478-144683500 CAGTAGGCAATGAAGGAGCCAGG - Intronic
1016937102 6:149455590-149455612 CTGGAGGCAGAGAGGGACACAGG - Intronic
1016992881 6:149942092-149942114 CGGGAGGCACAGAAGGATCTTGG - Exonic
1016996237 6:149964069-149964091 CGGGAGGCACAGAAGGAACGCGG - Exonic
1017074862 6:150608331-150608353 CCTGAGGAACAGAAGGAGACTGG + Intronic
1017117953 6:150996625-150996647 CTGTAGGCTCAGCAGGAACCAGG - Intronic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1018635204 6:165854560-165854582 AGGGCGGCACAGAGGGAGCCCGG + Intronic
1018905586 6:168073600-168073622 TTTGAGGCACAGAAGGGGCCGGG + Intronic
1019144946 6:169970548-169970570 CTGCAGGCACAGGAGGCCCCGGG - Intergenic
1019299557 7:296377-296399 CTGGGGGTCCAGAAGGGGCCTGG - Intergenic
1020260754 7:6529597-6529619 ATGGAGGGCCAGCAGGAGCCAGG - Intronic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022488384 7:30797978-30798000 CTGGAGGCACTGAAGGACCTGGG + Intronic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1022957084 7:35390874-35390896 CTGTGGGGACTGAAGGAGCCGGG + Intergenic
1023198258 7:37665517-37665539 TTGGAGGCAGTGCAGGAGCCGGG + Intergenic
1023722360 7:43110073-43110095 CTCGAGGCCCAGGAGGACCCAGG - Intergenic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1024194617 7:47047010-47047032 CTGGAGTCTCAAAAAGAGCCAGG + Intergenic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1025021184 7:55481365-55481387 CCAGAGTCACAGCAGGAGCCAGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1029664833 7:101988514-101988536 CTGGAGGGAAAGGAGGAGCAGGG - Intronic
1030068266 7:105677059-105677081 CAGGAGGCAGAGCAGGTGCCAGG + Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031380794 7:121083624-121083646 AGGGAGGTACAGATGGAGCCAGG + Intronic
1033224880 7:139553598-139553620 TTGGAGGCTCAGAAGAAGACAGG + Intergenic
1033865733 7:145688185-145688207 CTGGATGCACAGAAGCTGACAGG - Intergenic
1033879569 7:145863747-145863769 CTGGAGTAACTGAAGGAGACAGG + Intergenic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034347520 7:150396668-150396690 CTGGGGGGACAGGAGGAGTCTGG + Exonic
1034474841 7:151276228-151276250 GTGGAGACAGAGAAGGTGCCAGG + Intronic
1034760260 7:153665772-153665794 CTGGAGGCTCGGAAGGAGCCGGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035471072 7:159109273-159109295 CTGGGTGCAGAGGAGGAGCCTGG + Intronic
1035487312 7:159236187-159236209 CTGCAGGCCCAGGAGGAGTCAGG + Intergenic
1035698495 8:1620280-1620302 CCCGAGGGACAGGAGGAGCCCGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037594923 8:20346946-20346968 CTAGAGGCAGAGCAGGACCCAGG + Intergenic
1037651565 8:20843611-20843633 CTGGAGGCAGAAAATGGGCCAGG + Intergenic
1037819970 8:22130773-22130795 CCGGAGGGAGAGAAGGCGCCGGG + Exonic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1038402681 8:27297395-27297417 CTGGAGGAAGAGAGGGTGCCAGG + Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039475130 8:37835616-37835638 CTGGGGGCACCGGGGGAGCCAGG - Exonic
1041170885 8:55141256-55141278 CTGGAGGCAGAGGAGGAGGGAGG - Intronic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1041414961 8:57597812-57597834 CTGGGGGCACTGTGGGAGCCAGG - Intergenic
1042110407 8:65375731-65375753 CTGGAGGAAGAGATGCAGCCAGG - Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044522668 8:93217510-93217532 CCTGAGGCACAAAAGGAGCAGGG - Intergenic
1044716285 8:95102678-95102700 CTGCTGGTACTGAAGGAGCCAGG + Intronic
1044730587 8:95225812-95225834 TGGGAGGGACAGAAGGGGCCAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1047011022 8:120672897-120672919 TAGGAGGCACTGAAGGAGACTGG + Intronic
1047702395 8:127462098-127462120 TTGGAGGCAGGGAAGGAGTCAGG + Intergenic
1047905090 8:129464459-129464481 CTGAGGGAACAGAAGCAGCCTGG - Intergenic
1048274950 8:133059062-133059084 CTGGAGGCAGCGCAGGAACCTGG + Intronic
1048329968 8:133464687-133464709 GTGGAGGCACAGCAGGACCACGG + Intronic
1048614195 8:136056619-136056641 CTGAAGGAAAAGAAGGAGCCAGG - Intergenic
1049268648 8:141682705-141682727 CAGGAGGCCCAGAGGGAGACAGG + Intergenic
1049291529 8:141805509-141805531 ATGGAGGGAAGGAAGGAGCCTGG + Intergenic
1049381498 8:142318635-142318657 CTGGGGGCCGAGAAGGAGCCAGG + Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049588193 8:143441470-143441492 CTGGCAGCACAGAGGGAGCCCGG + Intronic
1049691780 8:143964537-143964559 CTGGAGCCTCCGAAGGAGCGTGG + Intronic
1049811958 8:144579632-144579654 GTGCAGGCACAGAGGGAGGCGGG - Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1052834379 9:33239808-33239830 CAGGAGGCAGAGAAGGGGGCTGG - Intronic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053122278 9:35556092-35556114 CTGGCAGCACTGAGGGAGCCAGG - Exonic
1053452008 9:38201457-38201479 CTTGAGGAACAGGAAGAGCCTGG + Intergenic
1055273179 9:74584809-74584831 CAGGAGCCACAGAATGAGTCTGG + Intronic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1056902503 9:90613027-90613049 CTGGAGTCACAGAATCTGCCAGG - Exonic
1057781975 9:98057229-98057251 AGGGAGCCACAGAAGGTGCCAGG - Intronic
1059347247 9:113637347-113637369 CGGAAGGCAAAGGAGGAGCCAGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060153272 9:121301996-121302018 CTCAAGGCAGGGAAGGAGCCTGG + Exonic
1060405501 9:123371047-123371069 CTGCAGGGAGAGAAGGTGCCAGG - Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060672831 9:125485397-125485419 CTGGAGACAGATAAGAAGCCTGG + Intronic
1061207280 9:129172145-129172167 CTTCAGGCACAGCAGGATCCAGG - Intergenic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061518506 9:131103491-131103513 CTAATTGCACAGAAGGAGCCTGG - Intronic
1061667801 9:132170457-132170479 CTGCAGGCCGAGAAGGAGGCAGG + Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062154128 9:135036972-135036994 GTGGGGGTACATAAGGAGCCTGG - Intergenic
1062235094 9:135504059-135504081 CTGCAGGGCCAGAAGGAGCCCGG + Exonic
1062331906 9:136048637-136048659 CTGCAGGCGGAGAGGGAGCCAGG + Intronic
1062401222 9:136373559-136373581 CTGCAGACACACCAGGAGCCTGG + Exonic
1062582731 9:137235644-137235666 CAGGAGGCACAGGCAGAGCCAGG + Intronic
1186474816 X:9849170-9849192 CTGGATGCACCCAAGGACCCAGG + Intronic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1187843071 X:23508871-23508893 TTGGAGGCACAGAAGAAGATAGG + Intergenic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1188655980 X:32695846-32695868 TTGGAAGAACAGAAAGAGCCAGG + Intronic
1189175570 X:38953866-38953888 ATGGAGGCTCAGAAGGATCAAGG + Intergenic
1189534806 X:41924488-41924510 GTGCAGGCACAGGAGCAGCCAGG + Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1192362760 X:70449754-70449776 GTGGAGGCGCTGAAGGAGGCAGG + Exonic
1192364050 X:70455970-70455992 CTTGAGGCACTGAAGGAGCATGG - Intronic
1192431880 X:71118417-71118439 CCGGAGGCGCAGAATGAGCTGGG - Intergenic
1196810591 X:119626082-119626104 CTGGAAGTACAGAAGAAGACAGG + Intronic
1196831049 X:119775834-119775856 CTGGAGGCCCACGAGGAGCTAGG - Intergenic
1197759565 X:130018079-130018101 CTGGAGCCAGACACGGAGCCTGG + Intronic
1197828203 X:130613264-130613286 CTGGTGCCACAGAATGAGCCAGG - Intergenic
1198762823 X:140051375-140051397 GTGGAGCCACAAAAGGAGTCGGG + Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic