ID: 930020881

View in Genome Browser
Species Human (GRCh38)
Location 2:47001464-47001486
Sequence CCTCATCTGCAGAGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 366}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930020868_930020881 22 Left 930020868 2:47001419-47001441 CCCTGGGACCTTATGCAAGGTAG 0: 1
1: 0
2: 0
3: 8
4: 133
Right 930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG 0: 1
1: 0
2: 5
3: 34
4: 366
930020869_930020881 21 Left 930020869 2:47001420-47001442 CCTGGGACCTTATGCAAGGTAGT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG 0: 1
1: 0
2: 5
3: 34
4: 366
930020866_930020881 30 Left 930020866 2:47001411-47001433 CCTCAGCTCCCTGGGACCTTATG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG 0: 1
1: 0
2: 5
3: 34
4: 366
930020870_930020881 14 Left 930020870 2:47001427-47001449 CCTTATGCAAGGTAGTTCATCTT 0: 1
1: 0
2: 2
3: 12
4: 193
Right 930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG 0: 1
1: 0
2: 5
3: 34
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930020881 Original CRISPR CCTCATCTGCAGAGGGTGGG GGG Intronic
900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG + Intergenic
900572867 1:3367979-3368001 CATCATCTGCAGAGAGCTGGAGG + Intronic
900964166 1:5945957-5945979 TCTCAACTGCAATGGGTGGGTGG - Intronic
901214484 1:7548296-7548318 CCTCTTCTGTAGACTGTGGGAGG + Intronic
901870951 1:12138977-12138999 CTGCTTCTGCAGAGGGTGGGTGG - Intronic
901874361 1:12158559-12158581 CCACATCTGCAGCGGGGCGGGGG - Intergenic
902774717 1:18667331-18667353 CCGCATCTTCAGAGAGTGGAAGG + Intronic
903269163 1:22177053-22177075 CCTCATTGGAAGGGGGTGGGTGG + Intergenic
904004592 1:27357109-27357131 CTTCACCTGCAGGGGGAGGGAGG + Exonic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904294203 1:29507209-29507231 CACCACCTGCAGAGGGTGAGGGG - Intergenic
904836729 1:33342520-33342542 CCTGAACTGCATGGGGTGGGGGG - Intronic
905175587 1:36133561-36133583 CCTCATCTGCAGATAGTAGTAGG + Intergenic
905267490 1:36764872-36764894 CCTTGGCTGAAGAGGGTGGGTGG - Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
907649879 1:56285105-56285127 CCTCCTCTGCAAAGGGTTGTTGG - Intergenic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
909593831 1:77381981-77382003 CTCCCTGTGCAGAGGGTGGGTGG - Intronic
911146178 1:94554621-94554643 CCCCATCTGGACAGGGAGGGAGG - Intergenic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
912818576 1:112849585-112849607 CCACGTCTCCAGGGGGTGGGAGG - Intergenic
915109360 1:153553262-153553284 CCACATCTGCAGTGGGGGCGGGG - Intergenic
915270570 1:154750549-154750571 CTTCATCTGGGAAGGGTGGGGGG + Intronic
915508347 1:156371606-156371628 CCCCTTCTGCCTAGGGTGGGTGG - Intronic
915917013 1:159946205-159946227 CCTCAGCTGCACACGGTGGGAGG - Intergenic
917345208 1:174022254-174022276 CCTCAGCAGCAGCAGGTGGGAGG - Exonic
917767867 1:178243386-178243408 CCTCATTTTCACAGGCTGGGAGG - Intronic
918038677 1:180898994-180899016 CCTCATCTGGACATGGTGGCTGG - Intergenic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
918760904 1:188405728-188405750 CCTCATCTGCCTAGCGTAGGAGG - Intergenic
919856544 1:201709974-201709996 CCACATCAGCAGAGTGTGGTGGG - Intronic
920180116 1:204127270-204127292 CCTCATGAGCACAGGGTCGGGGG + Exonic
921284832 1:213599972-213599994 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
921581759 1:216903778-216903800 CCAGAGCTGCAGAGGGTGGTTGG - Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924384788 1:243490718-243490740 CCTCATCTTCAGAGGGTCCTGGG + Intronic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1063442161 10:6081543-6081565 CATGAGCTGCAGAGAGTGGGAGG + Intergenic
1063607317 10:7534072-7534094 CCTGTGCTGTAGAGGGTGGGAGG - Intergenic
1063903861 10:10763294-10763316 TCTCATGTGCAGTGAGTGGGAGG - Intergenic
1064030567 10:11880304-11880326 TCTCATCAGAAGAGGCTGGGAGG - Intergenic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1066180798 10:32958572-32958594 CCTCCTCTGCGAAGGGCGGGAGG + Intronic
1067137538 10:43624640-43624662 CCTCCTCTGGAGAGGGTTGAGGG - Intergenic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1070306213 10:75240665-75240687 CCTCATCTGGAGAGGCTGAATGG + Intergenic
1071256588 10:83877261-83877283 CCTCATCTGCAGTGGAGGGATGG - Intergenic
1072551212 10:96479256-96479278 CCTCATCGCCAGTGGCTGGGAGG - Intronic
1072630753 10:97144901-97144923 CCTCATCTGTAAAGTGTTGGGGG - Intronic
1073293699 10:102425652-102425674 CCCTTTGTGCAGAGGGTGGGTGG - Intronic
1074039285 10:109772213-109772235 CCTCATCTGAGGAGGCAGGGAGG - Intergenic
1074052083 10:109889056-109889078 CCTCATCTGCAAGGGCAGGGTGG + Intronic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081711291 11:45217678-45217700 GCTCATCTGGAGAGCCTGGGAGG - Intronic
1082088650 11:48070579-48070601 TCTCATCTCCATAGTGTGGGTGG + Intronic
1083459380 11:62800481-62800503 CTTCAACTGCAAAGGGTGGAAGG + Exonic
1084735287 11:71101539-71101561 CTCCATCTGCAGAGGGTGAGAGG - Intronic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1084811863 11:71616872-71616894 CCTCATATCCAGAGGGCGAGAGG - Intergenic
1085034020 11:73289463-73289485 GCTCATCTGGGGAGGGTGAGTGG + Intronic
1086161053 11:83722543-83722565 CCTCACCTCCAGAGGCGGGGTGG + Intronic
1087155313 11:94896086-94896108 CCTCATCTGTAAATGATGGGTGG - Intergenic
1087377969 11:97367967-97367989 CTTCATCTGCAGGGGGTAGATGG - Intergenic
1088242119 11:107783671-107783693 CCTCATCTGGAGAGGGGCAGAGG - Intergenic
1089254572 11:117187548-117187570 GAGCATCTGCAGAGGGTGTGGGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091230933 11:133987534-133987556 CCTCATCGGGAGAGGCTGGGTGG + Intergenic
1093652170 12:21657982-21658004 CCTCATCTGGAGGGTGGGGGAGG - Intronic
1094498550 12:31004405-31004427 CGACATCAGCAGTGGGTGGGTGG - Intergenic
1095322401 12:40845646-40845668 TCTCATCTCCAGAGGCTGGCGGG - Intronic
1095476428 12:42590731-42590753 CCGGAACTGGAGAGGGTGGGGGG - Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096673374 12:53213487-53213509 CCTCATCTGCGGAGGTGCGGGGG - Exonic
1100717850 12:97324653-97324675 CGTCCTCTGCACAGGGAGGGAGG + Intergenic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1103184635 12:118945927-118945949 CCTCATCTAAAGGGGGTGGCAGG - Intergenic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1104946403 12:132416756-132416778 CCTCATCCCTAGAGGGAGGGGGG + Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108007898 13:45970964-45970986 TCTCATCTGAAAATGGTGGGTGG + Intronic
1108167662 13:47709955-47709977 CCACAGAGGCAGAGGGTGGGTGG - Intergenic
1109355590 13:61228097-61228119 CCTAATCTCCAGAGGGGGAGAGG - Intergenic
1109834560 13:67840545-67840567 CTTCAACTGCAGGGGTTGGGAGG + Intergenic
1110924320 13:81131534-81131556 CCACATCTGGAGTGGCTGGGAGG - Intergenic
1113113397 13:106848645-106848667 GCCTTTCTGCAGAGGGTGGGGGG - Intergenic
1113533996 13:111049935-111049957 CCACTTCTGCAGAGGCTGCGAGG + Intergenic
1113684490 13:112272933-112272955 CCTCATCTGGAGTGGGCAGGTGG + Intergenic
1113759373 13:112836995-112837017 CGTGACCTGCTGAGGGTGGGGGG - Intronic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1121586317 14:95065363-95065385 CATCAACTGCAGTGGCTGGGTGG + Intergenic
1121605515 14:95237313-95237335 CGGCACCTGCAGAGGCTGGGAGG + Intronic
1122037140 14:98957140-98957162 GTTCATCTGCAGATTGTGGGGGG + Intergenic
1122134533 14:99625251-99625273 CCTCCTCTGCAGATGGGAGGAGG - Intergenic
1122346102 14:101061557-101061579 CAGCATCCTCAGAGGGTGGGTGG - Intergenic
1122790640 14:104182849-104182871 GCTCACCTGCAGGGGATGGGTGG + Intergenic
1123114645 14:105889192-105889214 CCTCATCTTTAGAGGGAGTGCGG + Intergenic
1123137049 14:106037817-106037839 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1123206991 14:106723489-106723511 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123212010 14:106770492-106770514 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1125957731 15:43802009-43802031 CCTCATGTGCAGATGCTAGGTGG + Exonic
1126724627 15:51619836-51619858 CCTGCTCTGGAGAGGGTGTGTGG - Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128177279 15:65566958-65566980 CTTCATCTACACAAGGTGGGAGG - Intronic
1129109329 15:73328604-73328626 CCTCATCTGCAGGGCGGGGGTGG - Intronic
1131692997 15:94846405-94846427 CCTCACCTGCTGGGGTTGGGGGG - Intergenic
1131697367 15:94892500-94892522 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
1132558431 16:582815-582837 CCCCGTCTGCAGAGAGAGGGTGG - Intronic
1132561250 16:595287-595309 CCTCGTCTGCACAGTGGGGGTGG - Intronic
1132833307 16:1940366-1940388 CCTCCTCTGCAGAGTGGCGGTGG - Intronic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1133562185 16:6960581-6960603 CCTCCTCTGCAGAGTTTGGAAGG - Intronic
1134778459 16:16873390-16873412 CCTCTCCTGCAGAGGTGGGGCGG - Intergenic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1136772006 16:32848219-32848241 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1138769941 16:59651353-59651375 CATAATCTCCAGAGGTTGGGAGG - Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1141443802 16:84045504-84045526 CTGCATCTGCAGCCGGTGGGCGG + Intergenic
1141526220 16:84613829-84613851 CCACCTCTGGAGTGGGTGGGGGG - Intronic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1141964373 16:87431936-87431958 CCTCAGCTGCTGAGGTTTGGAGG - Intronic
1203074427 16_KI270728v1_random:1110308-1110330 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1143178879 17:4972282-4972304 CATCATCTGAAGCTGGTGGGAGG + Exonic
1143907962 17:10224963-10224985 GCAGATGTGCAGAGGGTGGGCGG - Intergenic
1144539856 17:16130374-16130396 CCTCAACTCCACAGGGTGGCTGG + Intronic
1144777468 17:17791979-17792001 CCTCACCTGCTGAGGTGGGGAGG + Intronic
1144848713 17:18233374-18233396 CCCCATCTGCAGAAGCTGGGAGG - Intronic
1146610513 17:34300897-34300919 TGTCTTCTGCAGAGAGTGGGTGG - Intergenic
1146624532 17:34425245-34425267 CTGCATCTCCAGAGGGTTGGGGG + Intergenic
1147427772 17:40354493-40354515 CCTCATCTGCGGAGGTGGGCAGG + Exonic
1147703652 17:42411606-42411628 CCTCAGCTGCAGGGAGTGGGTGG + Intronic
1148553973 17:48566835-48566857 CCTCATCTGGAAAGTGTTGGGGG - Intronic
1149638621 17:58189455-58189477 CCAGAGCTGGAGAGGGTGGGTGG + Intergenic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1151784426 17:76268472-76268494 AGTCATCCCCAGAGGGTGGGGGG + Intronic
1151890821 17:76949501-76949523 CCTCAAGTGTAGAGGGAGGGTGG - Exonic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153611742 18:6892816-6892838 GCTCATCTGCAAAGACTGGGAGG - Intronic
1157232885 18:45935700-45935722 ACACATGTGCAGTGGGTGGGAGG + Intronic
1157444771 18:47736493-47736515 CCTCACCTGCTGGGGATGGGAGG - Intergenic
1158747520 18:60218454-60218476 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
1160217090 18:76941493-76941515 CCACCTGTGCAGTGGGTGGGAGG - Intronic
1161284804 19:3463629-3463651 CCTCCTATGCCGGGGGTGGGGGG - Intronic
1162121963 19:8476211-8476233 TCTCAGCTGTAGAGGGTGTGGGG - Intronic
1162360516 19:10217294-10217316 CCCCATCTGTAGGGGCTGGGAGG + Intronic
1163334123 19:16660478-16660500 CCTGAGCTGCACAGGGTGCGGGG + Intergenic
1163384247 19:16989637-16989659 TCTTACCTGCAGTGGGTGGGAGG + Exonic
1165769414 19:38370142-38370164 ACTCCTCTGCAGGGGTTGGGAGG - Exonic
1166071946 19:40393086-40393108 CCTCACCGGCAGAGGGCAGGTGG + Intergenic
1166108912 19:40611135-40611157 CCACATCTGCACAGGGCAGGGGG - Exonic
1166752863 19:45172993-45173015 CCTTATCTGAGGAGGGTGTGGGG - Intronic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1167035899 19:46994805-46994827 GTTCATCCGCAGTGGGTGGGAGG - Intronic
1167048410 19:47065116-47065138 CCTCATCTGCAGAGCCCTGGAGG - Exonic
1167116630 19:47492576-47492598 CCTCATCCACAGTGGGAGGGAGG - Intronic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168320837 19:55508651-55508673 CCTCATCCACAGGGGATGGGGGG + Intronic
1168320859 19:55508725-55508747 CCTCATCCACAGGGGATGGGGGG + Intronic
1168320902 19:55508872-55508894 CCTCATCCACAGGGGATGGGGGG + Intronic
1168651711 19:58096385-58096407 CTTCATTTGCTGAGGCTGGGGGG - Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925616505 2:5748870-5748892 CCACAGCTTCATAGGGTGGGTGG - Intergenic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
926695354 2:15766837-15766859 CCTCAACTGCAGAGGAGGGGAGG + Intergenic
928399109 2:30965307-30965329 CCTCAGCTGCAGAGGTGAGGAGG - Intronic
929564707 2:42977066-42977088 CCTCAGCTGGGGTGGGTGGGAGG + Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932599374 2:73113100-73113122 CGGCCTCTGCAGAGGGTGGGCGG + Intronic
932621450 2:73266728-73266750 GCTCTCCTCCAGAGGGTGGGTGG - Intronic
932988997 2:76763569-76763591 ACTCATCTGCATAGGCTAGGTGG - Intronic
933456482 2:82525877-82525899 CCTCATATCCAGAGGGTGAGTGG - Intergenic
934904306 2:98185590-98185612 GCTCACCTGCAGAGAGTGAGTGG - Intronic
935698331 2:105789090-105789112 CCTCAGCTGAGGAAGGTGGGTGG - Intronic
937362233 2:121237350-121237372 CCTCACCTGCGGGGGGTTGGTGG - Intronic
940598772 2:155829631-155829653 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
941917880 2:170823849-170823871 CCTGGCCTGCTGAGGGTGGGGGG + Intronic
942233515 2:173881878-173881900 GCTCATCAGCTTAGGGTGGGGGG - Intergenic
946849358 2:223890045-223890067 CCTCATATACAGAGGCTGTGTGG - Intronic
947590009 2:231380098-231380120 CGTGATGTGGAGAGGGTGGGTGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
947833507 2:233158885-233158907 CCTCAGCTGAGGTGGGTGGGGGG - Intronic
947873989 2:233456307-233456329 CCACATCTGCAGAGAGCGTGTGG + Intronic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
948237916 2:236404091-236404113 CTTCCTCTACACAGGGTGGGTGG + Intronic
948452177 2:238082545-238082567 GGGCATCTGCAGAGGGTGTGGGG + Intronic
948469459 2:238167820-238167842 CCACCTCTGGAGAGGGTGGAAGG - Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948798811 2:240420807-240420829 TCCCATCTGCAGAGGGCGTGGGG - Intergenic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG + Intergenic
1170731861 20:18982965-18982987 CATCATTTGCAGGGAGTGGGAGG + Intergenic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1172878658 20:38182470-38182492 CCTCAACTGCAGGGGCTGGAAGG + Intergenic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1174116133 20:48227651-48227673 CCTCATCTGTAAGTGGTGGGTGG - Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1175202736 20:57289355-57289377 CATCCTCTGCATGGGGTGGGGGG + Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176742338 21:10616130-10616152 ACTCATCTGTTGATGGTGGGTGG + Intergenic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1179088406 21:38241312-38241334 ACTCCACTGCAGAGGGAGGGTGG - Intronic
1179146153 21:38769678-38769700 CCTGAACTGCACAGGGTAGGTGG - Intergenic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180001685 21:44998080-44998102 CCCCATCTTCTGAGGGTGGGAGG + Intergenic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1180931718 22:19596757-19596779 CCCCAGCAGCAGAGGGTGGTGGG - Intergenic
1181349159 22:22243212-22243234 CCTCCTCTGCACAGGCTGGTGGG - Intergenic
1181570626 22:23766237-23766259 CCCCATCTGCAGGGGCTGGGGGG + Exonic
1181878433 22:25958284-25958306 CCTCTTCTGTAGTGGGTTGGAGG - Intronic
1182347228 22:29674754-29674776 CCTCCTCTGCAGGGGTGGGGTGG + Intronic
1183282550 22:36939450-36939472 CCTCATCTGTGGCCGGTGGGAGG - Exonic
1183396556 22:37574779-37574801 CCTCCTCTGCAGAGAGGAGGCGG - Intronic
1184160567 22:42694943-42694965 CCTCATCTGTAGGGTGGGGGTGG - Exonic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184668473 22:46000823-46000845 CATCATCTGCCCAGGGTGGAAGG - Intergenic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
952273685 3:31857115-31857137 CTCCATCTGCAGAGGGCAGGGGG - Intronic
952764515 3:36943482-36943504 CATCCTCTGCGGGGGGTGGGGGG - Intronic
953607180 3:44419678-44419700 CATCAGCTCCACAGGGTGGGCGG - Intergenic
953644504 3:44741709-44741731 CACCATCTGCACAGGGTGTGAGG + Intronic
953932628 3:47013314-47013336 CCTCTTCTGGAGGGGATGGGTGG - Intergenic
954285549 3:49616567-49616589 CCTCAACTGAAGGCGGTGGGGGG + Intronic
954345197 3:49991394-49991416 CCTCATCAGAAGTTGGTGGGTGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954786093 3:53093583-53093605 CCTCATGTGCAGAATCTGGGTGG - Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
957254935 3:77824953-77824975 TCTCTTCTGTAGGGGGTGGGGGG + Intergenic
957274758 3:78076535-78076557 CCTGGTTTGCAGAGGTTGGGAGG + Intergenic
958153680 3:89725436-89725458 CCCCATCAGCAGAGGCTGAGTGG + Intergenic
958898820 3:99861534-99861556 AATCAACTGCAGAGAGTGGGAGG - Intronic
960101470 3:113747022-113747044 CCTCAGCTGCACAGGTTGGGGGG - Exonic
960937373 3:122912229-122912251 CCTCACCTGGGGAGGGTGCGGGG + Exonic
961622606 3:128236400-128236422 CCTCATCTGTAAATGGCGGGGGG + Intronic
961678704 3:128584301-128584323 CCCCATCAGCAGAGGGAAGGAGG - Intergenic
962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG + Exonic
962440878 3:135415149-135415171 ACTGCTCTGCAGAGGGTTGGTGG + Intergenic
963225890 3:142861227-142861249 CCTCCTCTGCAGAGAGTTGTAGG + Intronic
963605637 3:147410054-147410076 CCTCGGCTGGCGAGGGTGGGGGG + Exonic
964970463 3:162553687-162553709 CCTCATGTGTTGAGGGAGGGAGG - Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966815276 3:183885080-183885102 CCTCATCTGCAAATGCCGGGAGG - Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967871001 3:194228990-194229012 GAGCATCTGTAGAGGGTGGGGGG - Intergenic
968292659 3:197550690-197550712 GCCGATCTGCAGGGGGTGGGGGG + Intronic
968512743 4:1002715-1002737 CCTCATCTGCGGGGCGGGGGGGG - Exonic
969499074 4:7542147-7542169 CCTCATGGGCGGAGGGTTGGGGG + Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
971242071 4:24898206-24898228 CCTCACCTGGAGAGGGTTGGGGG + Intronic
971635365 4:29049819-29049841 GATCATCTGCAGAGGGAGCGGGG + Intergenic
972284465 4:37635013-37635035 CATCATCTGCATACGGTGGGCGG - Exonic
972436359 4:39039292-39039314 CTTCATATGCAGGGGGAGGGTGG + Intergenic
973801666 4:54484463-54484485 TCTCATCTGCATGGGGTGGTTGG - Intergenic
975743373 4:77452342-77452364 GCTCCTCTGCAGAGAGGGGGAGG + Intergenic
976087327 4:81419792-81419814 CCTCATCTGCAGAGGATTGGGGG - Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
977726507 4:100302673-100302695 CTCCATCTGCAGTGGGTGGGGGG - Intergenic
979504876 4:121484863-121484885 CCTCATCTCCAGAGAGCTGGAGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
983578917 4:169288268-169288290 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
984113041 4:175643925-175643947 CCGCATGTGCAGTGGGTGGCCGG - Intronic
984320230 4:178186428-178186450 CCACATCTGGAGAGAGTGGTGGG - Intergenic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
987379989 5:17275819-17275841 GCTCTTCTGCAGAGGCTGCGGGG - Exonic
988018847 5:25597333-25597355 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
991127206 5:63082889-63082911 GCTCCTCTGCAGAGAGGGGGAGG - Intergenic
994396282 5:99228105-99228127 CCTAATATCCAGAGGGTGAGAGG - Intergenic
995038481 5:107562006-107562028 CCTCAACTGCCAAGGGTGGCAGG - Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
998038751 5:138937609-138937631 CCTCATCAGAGGAGGGTTGGGGG + Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998814869 5:146002902-146002924 CCTCAGATGCAGGGGGTAGGAGG - Intronic
1000173706 5:158729044-158729066 CCTGCTCTGCAGAGATTGGGTGG + Intronic
1000460846 5:161516353-161516375 CCTCATCTGCAAAGCAGGGGTGG - Intronic
1001287645 5:170435471-170435493 CCTCATCTGGAGAGCGGGGCTGG + Intronic
1001492469 5:172165287-172165309 CCTCATCTGCAGAGTTGGGTTGG - Intronic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001652363 5:173324921-173324943 CCTAAACTGCAGAGGATGTGCGG - Intronic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005534958 6:26745739-26745761 CCCAATCTGAAGAGGGTGTGAGG - Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG + Intergenic
1006449665 6:34098854-34098876 CCTTAGCTGCAGAGAGGGGGTGG + Intronic
1006797995 6:36743162-36743184 CCTCCTCTGCAGGGGATGAGTGG + Intronic
1007387122 6:41527830-41527852 CCTCATGTCCTGAGTGTGGGTGG - Intergenic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1009362770 6:62835581-62835603 CCTAATTTCCAGAGGGAGGGAGG + Intergenic
1010722992 6:79304717-79304739 CTTAATTTGAAGAGGGTGGGTGG - Intergenic
1011445678 6:87436561-87436583 AGTCATCTGAGGAGGGTGGGGGG + Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1015565176 6:134562860-134562882 CCTCAATTGCAGAGGGCAGGTGG - Intergenic
1019025822 6:168962304-168962326 GCTCATCTGCACAGGGTTGGTGG - Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019647603 7:2139402-2139424 CCTTCACTGCTGAGGGTGGGGGG - Intronic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1021270497 7:18578466-18578488 CCTTCTCTGCAGAGGGTTAGAGG + Intronic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1023255889 7:38311663-38311685 CCCCATCTGCAGGGGCTGGGGGG - Intergenic
1023976194 7:45031987-45032009 TCTCAGCTGCAGGGGGTGGTAGG - Intronic
1024185000 7:46940599-46940621 CCTCAGCTCTAGAGGTTGGGGGG + Intergenic
1024283848 7:47740134-47740156 CCTCCTCTGCAGAGGGGGCCTGG + Intronic
1027145045 7:75688414-75688436 CTGCGTCTGCAGGGGGTGGGGGG + Intronic
1027793930 7:82668410-82668432 CCTCCTCTTCACAGGGTGGCAGG + Intergenic
1028414764 7:90567783-90567805 GATCATCTGCAGGGGATGGGAGG + Intronic
1029077836 7:97950058-97950080 CCTCATATCCAGAGGGCGAGAGG + Intergenic
1029413280 7:100428694-100428716 CCTCATTGGCAGAAGCTGGGGGG + Intronic
1029477593 7:100794197-100794219 CTTCAGCTGCAGAGCGGGGGAGG + Exonic
1030362134 7:108606358-108606380 CTTCATCTGCTGAAAGTGGGGGG - Intergenic
1031134547 7:117872220-117872242 CCCTACCTCCAGAGGGTGGGAGG + Intronic
1032885009 7:136128209-136128231 GCTCATCTGCAGGGGGCGTGAGG + Intergenic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1034433449 7:151052074-151052096 CCCCCACTGCAGGGGGTGGGAGG + Intronic
1034629074 7:152516526-152516548 CCTCATGAGGAGAGTGTGGGTGG - Intergenic
1035769123 8:2132914-2132936 CCTTATGTCCACAGGGTGGGAGG + Intronic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1037061047 8:14509946-14509968 CCTCACCTGTTGAGGGAGGGAGG - Intronic
1037438405 8:18888998-18889020 CCCCATGTGAAGATGGTGGGTGG - Intronic
1038350514 8:26771963-26771985 CCTCCTCTGCAGTGGAGGGGCGG + Intronic
1038795685 8:30707312-30707334 TCTCTTCTGCAGAGAGAGGGTGG - Intronic
1039790832 8:40874349-40874371 GCTCACCTGAAGATGGTGGGTGG + Intronic
1041566110 8:59280731-59280753 CCACACCTGGAGAGGGTGGTTGG - Intergenic
1043463634 8:80485767-80485789 TGTCATTTGCTGAGGGTGGGTGG - Exonic
1045684931 8:104702221-104702243 CCTCACCTGTCGAGGGAGGGAGG + Intronic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1048179546 8:132182487-132182509 CCTCATCTCCCCAGGGAGGGTGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049212348 8:141392473-141392495 CCTCAGCTGCACAGTTTGGGGGG + Intronic
1049223142 8:141436949-141436971 CCCCATCTGCACTGGGTGGGGGG + Intergenic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049372158 8:142273056-142273078 CCTCCTCTGCAGTGTGTCGGGGG + Intronic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049419714 8:142511232-142511254 GCGCCTCTGGAGAGGGTGGGTGG + Intronic
1049421355 8:142517980-142518002 CCTCGTCTGCAGGGGGCGGGTGG + Intronic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1049855072 8:144856629-144856651 CTTCACCTGCAGACAGTGGGTGG - Intergenic
1049963352 9:756984-757006 CCTCATTTGCTGAGGTTGAGAGG + Intergenic
1050279429 9:4034850-4034872 CTTCTTCTTCAGAGGGTGAGTGG + Intronic
1051600165 9:18864591-18864613 CATCTTCTGCTGAGGGTGCGAGG + Intronic
1052599604 9:30608233-30608255 CCCCATTTGTTGAGGGTGGGAGG + Intergenic
1052967167 9:34348891-34348913 GGTCATCTTGAGAGGGTGGGTGG - Intergenic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1054804032 9:69380937-69380959 GCTCAGCTGTAGAGGGTTGGGGG + Intronic
1055530223 9:77177094-77177116 CCTCATCATTACAGGGTGGGAGG - Intergenic
1055610449 9:78018956-78018978 ATTCTTCTGCAGCGGGTGGGAGG - Intronic
1056543210 9:87592211-87592233 CATCATCTGCAGTGGGCTGGGGG - Intronic
1056679798 9:88706924-88706946 GGACATCTGCAGAGGGTGTGCGG + Intergenic
1056925432 9:90830415-90830437 ACTCATCTGCAAAGGGCTGGGGG - Intronic
1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG + Intergenic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1057825460 9:98369346-98369368 CCTCATCTGGAGAGGACAGGGGG + Intronic
1059563468 9:115358426-115358448 CCTCATGTGTTGAGGGAGGGAGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060057902 9:120431571-120431593 CATCATCATCAGAGGGTGGTGGG + Intronic
1060611386 9:124968650-124968672 TCTCATCTACAGAGCCTGGGTGG + Intronic
1061303423 9:129719214-129719236 ACTCACCTGCGGAGGTTGGGGGG - Exonic
1185829940 X:3291444-3291466 GCACATCTTCACAGGGTGGGAGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187998143 X:24951353-24951375 CCTCGTCTGCATTTGGTGGGGGG - Intronic
1188005734 X:25014508-25014530 CCACAGCGGGAGAGGGTGGGGGG + Intronic
1190259574 X:48789644-48789666 CTTCCTCTGAAGAGGGTGGCAGG - Intronic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192185822 X:68946235-68946257 CCTCCTCTGCATGGGGTGGAGGG - Intergenic
1196761444 X:119204209-119204231 CCCCAGCTGCTGAGGCTGGGAGG + Intergenic
1197680432 X:129377128-129377150 CCACAGCTGGAGAAGGTGGGAGG - Intergenic
1198380410 X:136078170-136078192 ACTCATTTTCAGGGGGTGGGGGG + Intergenic
1201305041 Y:12542642-12542664 CCTCATCTGCAGGTTGCGGGTGG + Intergenic