ID: 930021862

View in Genome Browser
Species Human (GRCh38)
Location 2:47006570-47006592
Sequence CCTGGAAGGGTGCGGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930021849_930021862 17 Left 930021849 2:47006530-47006552 CCTGCAGCCTCCCAAAAGCGGTG 0: 1
1: 0
2: 0
3: 19
4: 142
Right 930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 261
930021854_930021862 6 Left 930021854 2:47006541-47006563 CCAAAAGCGGTGACTTGGGCAGT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 261
930021853_930021862 7 Left 930021853 2:47006540-47006562 CCCAAAAGCGGTGACTTGGGCAG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 261
930021851_930021862 10 Left 930021851 2:47006537-47006559 CCTCCCAAAAGCGGTGACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 67
Right 930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 261
930021847_930021862 20 Left 930021847 2:47006527-47006549 CCTCCTGCAGCCTCCCAAAAGCG 0: 1
1: 0
2: 2
3: 53
4: 668
Right 930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930021862 Original CRISPR CCTGGAAGGGTGCGGATGGC TGG Intronic
900163884 1:1237069-1237091 GCAGGGAGGGTGCGGAGGGCAGG - Intergenic
900643532 1:3698491-3698513 CCTGGAAGGGAGGGGCTGGTGGG + Intronic
901236580 1:7670536-7670558 CCTGGAAGGAAGCCGAGGGCAGG - Intronic
901425974 1:9182624-9182646 CCCGGAAGGGTCGCGATGGCCGG - Intergenic
901813713 1:11782096-11782118 CCTGGTAGGGGGCGAAGGGCTGG + Intronic
902534101 1:17109086-17109108 TCTGGAAAGCTGGGGATGGCTGG + Intronic
902697875 1:18152573-18152595 CCTGCAAAGGTTCGGATGCCTGG - Intronic
903282916 1:22260226-22260248 CCTGGAAGCTTGTGGATTGCAGG + Intergenic
903879846 1:26501014-26501036 CCTGGAAGGGCGGGGTCGGCGGG + Intergenic
904438156 1:30512716-30512738 CCAGGGAGGGTGTGGGTGGCTGG - Intergenic
907519474 1:55013845-55013867 GCTGGAAAGGTGAGGATGCCGGG - Intergenic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
917582242 1:176391075-176391097 CCAGCAAGGGTGCTGATGGACGG - Intergenic
918082406 1:181217782-181217804 CCTGGAAGAGAGGGGCTGGCAGG + Intergenic
918566748 1:185943092-185943114 CTTGGAAGGATCTGGATGGCAGG + Intronic
920250156 1:204618007-204618029 CCAGGAAGGGTGTGGGTGGGAGG - Exonic
920312446 1:205056570-205056592 CCTGGAAGAGGACTGATGGCTGG + Intronic
920331094 1:205208981-205209003 CCTGGGAGGGTGCAGATGGCAGG - Intronic
920442335 1:205989411-205989433 CCTGGCAAGGTGAGGAGGGCGGG - Intronic
920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG + Intronic
922499079 1:226083620-226083642 CCTGGGAGAGCGCGGGTGGCTGG - Intergenic
923145227 1:231193013-231193035 CCTGGAAGGCTGGCGCTGGCTGG + Intronic
923792946 1:237127433-237127455 CCCAGAAGGGGGCGGCTGGCCGG + Intronic
1064034098 10:11901492-11901514 CTTGAAAGGGTGGGGAGGGCGGG - Intergenic
1064314667 10:14244273-14244295 CCTGGAAGGGGGTGGAAGTCTGG - Intronic
1068518392 10:58051784-58051806 TCTGAAAGGGTGCCGAGGGCAGG - Intergenic
1073060021 10:100728276-100728298 CCTGGAAGGTTGGGGATGCGAGG + Intergenic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073451137 10:103610077-103610099 CCTTGAAGGATGAGGAAGGCTGG - Intronic
1076387094 10:130065097-130065119 CCAGGAAGGGTGGGGTAGGCTGG + Intergenic
1076710892 10:132333510-132333532 CCTGGAAGAGAACGGATGGAGGG + Exonic
1076888167 10:133272003-133272025 CCTGGTGGGGTGAGGGTGGCAGG - Intronic
1077037040 11:500236-500258 GCTGGAAGGCTAGGGATGGCGGG + Intronic
1077168787 11:1157211-1157233 CCAGGGAGGGTGAGGCTGGCTGG + Intergenic
1078830304 11:14971847-14971869 CCTGGAACAGAGCGGATGGGTGG - Intronic
1083037818 11:59656821-59656843 CATGGAAGGGTGGGGATAACTGG - Intronic
1083749336 11:64752787-64752809 CCTGGAAGGGGGCAGATATCTGG - Intronic
1083968289 11:66056686-66056708 CCTGGAAGTGTGGGGGTGGAGGG + Intronic
1084457947 11:69279202-69279224 CATGGATGGGTGCGTATGGATGG - Intergenic
1084603526 11:70160154-70160176 CATGCAAGGGTGCAGAGGGCAGG - Intronic
1084603612 11:70160536-70160558 GCTAGAAGGGTGCTGCTGGCTGG + Intronic
1085778054 11:79383633-79383655 CCAGGGAGGGTGCTCATGGCCGG + Intronic
1086402468 11:86472086-86472108 TGTGGATGGGTGCGGATGGAAGG + Intronic
1089106664 11:116012850-116012872 CCTGTAAGGATGAGAATGGCAGG - Intergenic
1089601016 11:119615136-119615158 CCTGGCACTGTGCTGATGGCTGG + Intergenic
1091344443 11:134843517-134843539 CCTGGGAGGATGCGGCTGGCAGG - Intergenic
1091550547 12:1531930-1531952 CCTGGACGAGTGCTGGTGGCTGG - Intronic
1092941942 12:13418053-13418075 GATGGAAGGATGGGGATGGCAGG - Intergenic
1095954765 12:47799660-47799682 CCTGGCATGGTCAGGATGGCAGG + Intronic
1098024014 12:66183990-66184012 ACTGGAAGGGTGCAGTTGCCAGG + Intergenic
1099016904 12:77354140-77354162 GATGGAAAGGTGCAGATGGCTGG + Intergenic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1099649060 12:85401090-85401112 ACTGGAAGGCTGAGGATGGAAGG + Intergenic
1101843891 12:108346372-108346394 CCTGGGAGGGGTCGGAGGGCTGG + Intergenic
1101900664 12:108789096-108789118 GCTGGCTGGGTGCAGATGGCGGG + Exonic
1102339221 12:112108625-112108647 CCAGGAGGGGTGCTGAGGGCCGG - Intronic
1103010873 12:117457283-117457305 CATGGAAGGTTGCAGATGGCAGG + Exonic
1103488293 12:121297049-121297071 CCTGGAGGGGCGCGGAGCGCAGG + Intronic
1103623909 12:122204630-122204652 CCTGGTGGGCTGCGGAAGGCTGG - Exonic
1105407273 13:20142861-20142883 CGCGGCAGGGTGCGCATGGCCGG - Exonic
1105606627 13:21931492-21931514 ACTGGAAGTGGGCTGATGGCAGG - Intergenic
1106927424 13:34628031-34628053 CCTGGAAGGGTGAGGCTGATTGG + Intergenic
1108523272 13:51263403-51263425 CCTGGAAGGGTGAGGACGCAGGG - Intronic
1111123484 13:83882339-83882361 CGTGGAGGGGGGCGGAGGGCGGG + Exonic
1111289162 13:86140798-86140820 CCTGGAGGGCTGGGGATGCCAGG - Intergenic
1114288010 14:21263754-21263776 TCTGGAAGGGTGGGGAAGGGAGG + Intronic
1115456933 14:33614483-33614505 CCTGGAGAGGTGAGGGTGGCAGG + Intronic
1115761743 14:36582902-36582924 CCGGGAAGGGTGGGGGTGGCAGG + Intergenic
1116313624 14:43359406-43359428 CCTGGAAGGTTGCACTTGGCAGG + Intergenic
1119380677 14:74226250-74226272 CCTGGTAGGGTGGGGGTGGAGGG - Intergenic
1119413718 14:74455770-74455792 TCTGGAAGGGAGAGGATGGGAGG - Intergenic
1119791998 14:77359313-77359335 CCTGGAAGGGTCCTGAGTGCAGG - Intronic
1120262195 14:82199796-82199818 CCTGAAAGGTGGCTGATGGCTGG + Intergenic
1122019779 14:98828151-98828173 CATGAAGGGTTGCGGATGGCTGG - Intergenic
1122113763 14:99517811-99517833 CCTGGAAGGGTCCATGTGGCTGG + Intronic
1122455437 14:101846726-101846748 CCTGGAAGAGGGCTGAGGGCTGG + Intronic
1123704993 15:22944816-22944838 CCTGGCAGGGTGTGGCTGGAGGG + Intronic
1124466832 15:29947852-29947874 CCTGGAACAGTGCGGAAGGCTGG + Intronic
1125371591 15:38983778-38983800 CCTGGATGGGGGCGGGGGGCGGG + Intergenic
1126517035 15:49550079-49550101 CCTGGACGGGGGCGGCTGGCCGG + Intronic
1126547124 15:49885925-49885947 CCTGGAAGGGTCAGCATGGGAGG + Intronic
1128151051 15:65363652-65363674 CCTGGCAGGAGGCGGGTGGCGGG - Intronic
1129063863 15:72884351-72884373 CCTGGAAAGGGGCGTATGACCGG + Intergenic
1130847304 15:87759241-87759263 CCTGAATGGGAGGGGATGGCAGG + Intergenic
1131993529 15:98112932-98112954 TCTGGATGGGTGGGGATGGGTGG + Intergenic
1132483904 16:180573-180595 CCTGGAAAGGTGCGGCAGGCTGG + Exonic
1133231115 16:4367058-4367080 CCTGGAAGTGTGGGGAGGGGAGG - Intronic
1133732438 16:8589184-8589206 CCGGGGAGGGTGAGGATGGAGGG - Intronic
1135735840 16:24931216-24931238 GCTGGGAGGGGGCGGAGGGCTGG + Exonic
1135966837 16:27042524-27042546 CCTGGAAGGGTGGGGAAGTTCGG - Intergenic
1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG + Intronic
1136147036 16:28321834-28321856 CCTGGGACAGTGCGGCTGGCAGG - Exonic
1136375668 16:29863722-29863744 CCTGGAGGGGTACGGAGGGGAGG + Exonic
1138521736 16:57575124-57575146 CCTGGCAGGGGGTGTATGGCTGG + Intronic
1141642863 16:85351508-85351530 CCTGGAAGGATGGGGTTGACGGG + Intergenic
1142385332 16:89760421-89760443 CCTGGAAGGCCCCTGATGGCCGG + Intronic
1142566810 17:845486-845508 CCTGTAAGGGTGATGATGGTAGG - Intronic
1143361808 17:6377193-6377215 CCTGGGAAGGTGCGGTTGCCAGG - Intergenic
1143652062 17:8269246-8269268 CCTGGAAGGGAGCTGCTGACTGG + Exonic
1144639777 17:16930993-16931015 CCTGGAAGGGCCAGGGTGGCCGG - Intronic
1145993658 17:29093599-29093621 CCTGGGAGGGTGAGGAGGGATGG + Intronic
1147358849 17:39918666-39918688 CCTGGACGGGTGGGTAGGGCTGG + Intronic
1148107738 17:45128309-45128331 CCTGGTTGGGTGCGGAAGTCAGG + Intronic
1148181983 17:45612743-45612765 CATGGCAGGGAGGGGATGGCGGG + Intergenic
1148266876 17:46232957-46232979 CATGGCAGGGAGGGGATGGCGGG - Intergenic
1148588313 17:48796700-48796722 CCAGGAAAGGTGGGGATGGCAGG + Intronic
1150681687 17:67289800-67289822 CCTGGAAGGGAGCAGCAGGCTGG + Intergenic
1151318456 17:73338176-73338198 GCTGGAAGGGGGCAGCTGGCTGG + Exonic
1155956730 18:31960982-31961004 CCCGGAAGGGGGCGGCTGGCCGG - Intergenic
1156449956 18:37261261-37261283 CCTGGAAGAGTGAGGATGGGAGG - Intronic
1156485646 18:37463982-37464004 CCTGGGAGTCTGCGGGTGGCAGG - Intronic
1156514714 18:37670130-37670152 CATGGAAGGGTGGGGACTGCTGG - Intergenic
1156544931 18:37955211-37955233 CATGGAATGGTGGGGATGGAAGG - Intergenic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1157604796 18:48919365-48919387 CCTGGAAGGGTGATGAAGGTGGG - Intergenic
1158232787 18:55277720-55277742 TCTGGAAGGGTGCACATTGCAGG - Intronic
1160898051 19:1412055-1412077 CCTGGGAGGGCGGGGCTGGCAGG + Intronic
1160916542 19:1499389-1499411 CCCGGACGGGGGCGGCTGGCCGG + Intergenic
1161720593 19:5900148-5900170 CCTGGAGGGGTGGATATGGCAGG - Intronic
1162894793 19:13758846-13758868 CCTGGGAGGGAGCGGTGGGCAGG - Exonic
1165722298 19:38088163-38088185 CCTGGCACGGTGCTGAAGGCTGG + Intronic
1166691099 19:44821494-44821516 CTTGCAAGGGGGCGGATGGGGGG - Intergenic
1167548377 19:50142881-50142903 CCTGGAGGAGTGGGGCTGGCTGG - Intergenic
925177149 2:1793826-1793848 CCTGCAAGGGGGCGGCTGGGAGG - Intronic
925300092 2:2805554-2805576 CCAGGAAAGGTGCAGATGTCTGG + Intergenic
926776816 2:16431276-16431298 CCTGGAAAGATGCTGATGGAGGG + Intergenic
926821437 2:16855347-16855369 CCCGGAGGGGTGGGGAGGGCTGG - Intergenic
928366329 2:30706054-30706076 CCTTGAGGGGTGGGGGTGGCAGG + Intergenic
929531467 2:42755709-42755731 CCAGAAAGGGAGCGGGTGGCTGG - Exonic
929893614 2:45939042-45939064 CCTGGCAGGGTGCTGTGGGCTGG - Intronic
930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG + Intronic
931480372 2:62633449-62633471 CCTGGAAGGGGGCTGAAGCCAGG + Intergenic
932820079 2:74892008-74892030 CTTGGAAGTGTGTGGAAGGCAGG + Exonic
933033185 2:77358386-77358408 CTTGGTTGGTTGCGGATGGCAGG - Intronic
934161952 2:89258075-89258097 CCTGGTAGTGTGAGGATAGCAGG - Intergenic
934205330 2:89924287-89924309 CCTGGTAGTGTGAGGATAGCAGG + Intergenic
935617822 2:105103669-105103691 GCTGGAATGGAGCAGATGGCCGG - Intergenic
938072796 2:128317396-128317418 CCTGGAAGAATTCGGCTGGCAGG + Intronic
940013336 2:149078069-149078091 CCTGGTAGGCTGAGGATGTCAGG + Intronic
941814430 2:169785677-169785699 CCCGGACGGGGGCGGCTGGCCGG + Intergenic
942315672 2:174694302-174694324 CCTGGAAGGGCAGGGAGGGCTGG + Intergenic
945251274 2:207768228-207768250 CCTGGAAGGGTGGGCTTGGCTGG + Exonic
945307615 2:208273635-208273657 CCTCGAAGGGAGCTGAGGGCTGG - Exonic
946362620 2:219228549-219228571 CTTGGTGGGGTGTGGATGGCTGG - Intronic
946599872 2:221348103-221348125 CCGGGAAGGGTAAGGATGTCAGG + Intergenic
947166173 2:227264359-227264381 CCTGGAAGTGGGAGGATGGGAGG - Intronic
947179995 2:227403257-227403279 CCAGGAAGGGGGTGGAGGGCAGG + Intergenic
947466110 2:230347881-230347903 TCTGCTAGGGTGCTGATGGCAGG + Intronic
947543084 2:230991768-230991790 CCTGGCAGGGTGGAGCTGGCAGG - Intergenic
947722427 2:232378198-232378220 CCTGGACAGGTGGGGCTGGCAGG - Intergenic
947726767 2:232406309-232406331 CCTGGACAGGTGGGGCTGGCAGG - Intergenic
948315803 2:237027395-237027417 CATGGAAGTGGGCAGATGGCAGG - Intergenic
948578497 2:238969143-238969165 CCTGGCAGGCTGCGGGCGGCTGG - Intergenic
948884706 2:240876912-240876934 CCTGGCAGAGTGCAGATTGCAGG + Intronic
1168954596 20:1826205-1826227 GCTGGAAGGCTGCAGATGGGTGG - Intergenic
1169774375 20:9236300-9236322 TCTGGAAGGCGGCGGTTGGCAGG - Intronic
1170523337 20:17211216-17211238 CCTGGAAGGGTGAGGAAGTGGGG - Intergenic
1171011555 20:21512057-21512079 CCTGGAAGGTGGCGGCTGCCAGG + Exonic
1173618654 20:44419699-44419721 CCTGGAAGGGTTGGGAGGGAGGG - Exonic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174047192 20:47741806-47741828 CCTGGAAGGGAACGCAGGGCAGG + Intronic
1174317365 20:49713392-49713414 CCTGTTGGGGTGCGGAGGGCAGG + Intronic
1175408253 20:58749251-58749273 CCTCAAAGGGTGTGGGTGGCTGG + Intergenic
1175870756 20:62208398-62208420 CCTGGTAGGGGGCGGCAGGCTGG - Intergenic
1175900990 20:62359880-62359902 CCTGGAAGGCTGAGGAGGGCGGG - Intronic
1176382655 21:6120915-6120937 CCTGGGTGGGTGAGGGTGGCGGG + Intronic
1177195330 21:17898714-17898736 TCTGGAAGGCAGCAGATGGCTGG + Intergenic
1179740814 21:43417324-43417346 CCTGGGTGGGTGAGGGTGGCGGG - Intronic
1180148230 21:45933877-45933899 CCAGGGAGGGTGTGGCTGGCAGG + Intronic
1180762543 22:18221019-18221041 CCTGGAAGGCTGTGCATGGCTGG - Intergenic
1180773124 22:18403589-18403611 CCTGGAAGGCTGTGCATGGCTGG + Intergenic
1180804479 22:18653138-18653160 CCTGGAAGGCTGTGCATGGCTGG + Intergenic
1180806271 22:18716272-18716294 CCTGGAAGGCTGTGCATGGCTGG - Intergenic
1181217218 22:21342053-21342075 CCTGGAAGGCTGTGCATGGCTGG - Intergenic
1182079417 22:27518554-27518576 CCTGGAAGGCTGCTGGAGGCTGG - Intergenic
1183730560 22:39616234-39616256 CCAAGATGGGGGCGGATGGCGGG + Intronic
1184039565 22:41934973-41934995 CCTGGAAGGCGGGGGATGGGTGG - Intergenic
1184222527 22:43110140-43110162 GCTGGAAGGCTGCGGACGGGCGG + Intergenic
1184795374 22:46729028-46729050 CCTGGCTGGGTACAGATGGCAGG - Intronic
1185081240 22:48710512-48710534 CCTGGACGGATGCGGGAGGCTGG - Intronic
1185100120 22:48835889-48835911 CCTGGAAGGAGCCGGATGGGTGG - Intronic
1185272887 22:49936771-49936793 ACTGGAGGGGTGTGGATGGAGGG - Intergenic
1185280144 22:49966458-49966480 CCTGCAGGGGTGAGCATGGCTGG - Intergenic
1203234956 22_KI270731v1_random:144571-144593 CCTGGAAGGCTGTGCATGGCTGG + Intergenic
950510908 3:13426009-13426031 CCTGGGAGGCTGTGGAGGGCTGG - Intergenic
950879610 3:16312467-16312489 ACGGGAAGGGTGAGGATGACTGG - Intronic
950934215 3:16822340-16822362 CCTTGAAGGGTGGGTATGGATGG + Intronic
955534084 3:59904704-59904726 CATTGAAGGGTGAGGAGGGCAGG + Intronic
958572869 3:95911080-95911102 CCTGGAAGCTTGGGGATGCCAGG + Intergenic
958844450 3:99249487-99249509 TCTGTAAGGGTGAGGATGGAAGG - Intergenic
960749915 3:120937072-120937094 CCTGGAAGGCTGGAGATGGCTGG + Intronic
961749347 3:129086289-129086311 CTTGGGAGCGTGCGGATGGCCGG + Intergenic
961756041 3:129127977-129127999 CTTGGGAGCGTGCGGATGGCCGG - Intronic
962829690 3:139129096-139129118 ATTGGAAGGGTGGGGAGGGCAGG + Intronic
967390475 3:188949369-188949391 GCAGGAAGGGTGCTGATGCCAGG - Intronic
968618399 4:1592653-1592675 CCTGGAAGCCTGGGGATGGGAGG + Intergenic
968803290 4:2756542-2756564 CCCGGACGGGTGCGGACGGCAGG - Intergenic
969172446 4:5375142-5375164 CACGGAAGGGTGTGCATGGCAGG - Intronic
973885352 4:55315486-55315508 CCTGGAACAGTGCGGAGGTCTGG - Intergenic
974075281 4:57163403-57163425 TCTGGAATGGTGTGGGTGGCAGG - Intergenic
975671142 4:76782004-76782026 CCTGGAACCTTGCGGGTGGCTGG - Exonic
977095792 4:92742388-92742410 GCTGGAGGGGTGCAGATGACAGG - Intronic
978498553 4:109385162-109385184 CCTGGAAGGTTGGAGATGTCAGG - Intergenic
981089832 4:140721076-140721098 CCTAGAAGGGTGGGGAAGACTGG + Intronic
981131559 4:141162966-141162988 CCTGGAAGGGGGCTGAAGCCAGG + Intronic
985177365 4:187215709-187215731 CCTGGCAGGGTAAGGGTGGCAGG + Intergenic
985583449 5:712485-712507 TCTGGAAGGATGGGGAGGGCAGG - Intronic
985596964 5:796783-796805 TCTGGAAGGATGGGGAGGGCAGG - Intronic
985656189 5:1132622-1132644 CCTGGAATGGTCCAGAAGGCAGG - Intergenic
985926696 5:3024827-3024849 CCTTGAAGGGAGAGGACGGCTGG - Intergenic
988837180 5:35044863-35044885 CCTGGAGGGGTGTAGATGGGAGG + Intronic
990248178 5:53884379-53884401 CCTGAACGGGTGGGGATGGGTGG - Intronic
990803489 5:59631906-59631928 CCTGGAAGGGGGCTGAAGCCAGG + Intronic
995132514 5:108645426-108645448 GCTGGAAGGCTGCGCATGGGAGG - Intergenic
995269975 5:110208897-110208919 CCTTGAAGGGGGAGGATGGGAGG - Intergenic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
998270101 5:140698745-140698767 TCTGCATGGGTGCAGATGGCTGG + Exonic
998703988 5:144737915-144737937 CCAGGAAGGGTGAGGTTGGCCGG + Intergenic
998964551 5:147525015-147525037 CCTGGGAGGGTGCGGTGGGGTGG + Intergenic
999697959 5:154202962-154202984 CCTGGCAGGGCTTGGATGGCAGG - Intronic
1000105810 5:158057875-158057897 GGAGGAAGGGTGCAGATGGCAGG - Intergenic
1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG + Intronic
1001783934 5:174395355-174395377 ACTGGGAGGGTGGGGAGGGCTGG + Intergenic
1002313374 5:178328110-178328132 CCTGCCTGGGTGCGGAGGGCAGG + Intronic
1002605699 5:180381540-180381562 CCTGGCTGGGTGCAGACGGCAGG + Intergenic
1002666911 5:180831706-180831728 CCGGGTAGGGTGCGGAGGTCGGG - Intergenic
1003114926 6:3277357-3277379 CCTGGAAGGGTGAGGGTGGGCGG - Intronic
1003925927 6:10877392-10877414 CCTGGAAGAGTGCAGAAGGAAGG + Exonic
1006151969 6:31994533-31994555 CCTGGCTGGGGGCGGAGGGCTGG + Exonic
1006158271 6:32027271-32027293 CCTGGCTGGGGGCGGAGGGCTGG + Exonic
1007214875 6:40229083-40229105 CCTGGAAGCTTGGGGATGCCAGG - Intergenic
1007801399 6:44396875-44396897 CCTGGAAGGGTCCTGAGTGCAGG + Intronic
1009805291 6:68594783-68594805 CCTGTAAGGGGGTGGAGGGCTGG - Intergenic
1009870769 6:69450215-69450237 CCTGGAAGATTGCAGATGCCAGG + Intergenic
1010727569 6:79352766-79352788 CCTGTCAGGGTGCGGGGGGCTGG + Intergenic
1012302903 6:97612318-97612340 CCTGGAAGGGGGCTGAAGCCAGG - Intergenic
1015068315 6:129058139-129058161 CATGCATGGGTGAGGATGGCAGG - Intronic
1017843879 6:158240540-158240562 CCCGGACGGGGGCGGCTGGCCGG + Intronic
1019167479 6:170108357-170108379 CCTGGAAGTGTGGAGGTGGCCGG - Intergenic
1019304188 7:325020-325042 CCCGGAAGGGTGCGGGAGACGGG + Intergenic
1019541644 7:1554394-1554416 CCAGGAAGGCTGTGGAGGGCTGG - Intronic
1020759123 7:12246171-12246193 CCTGTAAGGGTGGGGCTGGGAGG + Intergenic
1022105037 7:27191372-27191394 CCTGGAAGGGTGTGTAGGGGAGG - Intergenic
1022259621 7:28691593-28691615 AGTGGAAGGGTTAGGATGGCGGG + Intronic
1022375362 7:29806880-29806902 CGTGGCAGGGTGCGGGTGGGGGG - Intronic
1023740647 7:43278013-43278035 CCAGGAAGGGTATGGATAGCAGG - Intronic
1024565956 7:50681227-50681249 CCTGGCAGGGTGCAGAAGGCTGG + Intronic
1026829213 7:73600910-73600932 CCCGGAAGGGAGCGGGTGGGCGG - Intronic
1026874359 7:73871019-73871041 GCTAGATGGGTGAGGATGGCCGG + Intergenic
1027189663 7:75989393-75989415 CCAGGAAGGCTGGGCATGGCAGG - Intronic
1031174240 7:118329090-118329112 CAGGGAGGGGTGAGGATGGCGGG + Intergenic
1032097553 7:128947119-128947141 CCTGGAAGGGGGCTGATGGGAGG + Intronic
1032551264 7:132786660-132786682 GCTGGAAGGGTGCGGGTTGGCGG - Intronic
1033967327 7:146992428-146992450 CTTTGAAGGGTGAGAATGGCAGG + Intronic
1035177765 7:157064442-157064464 CCTGGAAGGTAGGCGATGGCTGG + Intergenic
1037345237 8:17891793-17891815 GCTGGAAGGGTGAAGATGGAGGG - Intronic
1038338262 8:26662616-26662638 CCTGGTGGGGTGCGGAGGACAGG - Intergenic
1038701785 8:29855774-29855796 CATGGGAGGGTGGGGAGGGCTGG - Intergenic
1040994136 8:53384568-53384590 CATTGAAGGGTGAGGAGGGCTGG + Intergenic
1048421607 8:134283455-134283477 CCTGGAAGCTTGCAGATGCCAGG + Intergenic
1049182701 8:141231164-141231186 CCAGGATGGGTGCGGAGGGTGGG + Intronic
1049280784 8:141743151-141743173 CTTGGACAGGTGCGGATGACAGG + Intergenic
1049280809 8:141743262-141743284 CCTGGACAGGTGCAGATGACAGG + Intergenic
1049280832 8:141743357-141743379 CCTGGACAGGTGTGGATGACAGG + Intergenic
1049285152 8:141770747-141770769 GCTGGAAGGGTAGGGAGGGCAGG - Intergenic
1049334719 8:142077259-142077281 TCTGGGAGGGTGAGGCTGGCTGG - Intergenic
1049519360 8:143080338-143080360 CCTCAAAGGGCGCGGAGGGCGGG - Intergenic
1051782807 9:20708665-20708687 CTTGGAAGGCTGAGGATGGGCGG + Intronic
1054882440 9:70159092-70159114 CCTGGAAAGGTGAGGATGCAAGG + Intronic
1054892780 9:70270291-70270313 TCTGGAAGGGTCCGGAGTGCAGG + Intronic
1055512824 9:77012216-77012238 CCTGGCAGACTGCGGAGGGCGGG + Intergenic
1056252320 9:84762293-84762315 CCTGGAATGGTGTGGATGTCAGG + Intronic
1056951426 9:91043453-91043475 TGTGGGAGGGTGCGGAAGGCTGG - Intergenic
1058618561 9:106861107-106861129 CCTAAAAGGGTGTTGATGGCGGG - Intergenic
1059511802 9:114855241-114855263 TCTGGAAGGGTCCAGATGGCAGG + Intergenic
1060485639 9:124044894-124044916 CCTGGAGGGAGGCGGAGGGCCGG - Intergenic
1060720461 9:125973055-125973077 CCTTGAAGGTTGGGGGTGGCAGG - Intergenic
1060730569 9:126034251-126034273 CCTGGCAGGAAGCTGATGGCAGG + Intergenic
1060796609 9:126516335-126516357 CCTGGAGTGGTGGGGGTGGCGGG - Intergenic
1061201454 9:129140746-129140768 CCTGGAAGTGTGCACAGGGCTGG + Intronic
1061802373 9:133119669-133119691 CCTGGGAGGGTGGGGGTGGGAGG - Intronic
1062361404 9:136190071-136190093 CCTGGAAGGGTGTGGCCGGAGGG - Intergenic
1062574262 9:137199254-137199276 CCTGGCAGGGTGCAGAGGCCTGG + Exonic
1062574269 9:137199272-137199294 CCTGGCAGGGTGCGGGAGGTAGG + Exonic
1190322851 X:49188629-49188651 CTTGGAAGGGCGCTGAGGGCAGG - Exonic
1190706413 X:53031788-53031810 TCTGGAAGGGTGCTGAGTGCAGG - Intergenic
1192924238 X:75738691-75738713 TCTGGAGGGGTGGGGATAGCTGG - Intergenic
1193360009 X:80570785-80570807 CTTGGAAGTGTGTGGAAGGCAGG - Intergenic
1193637355 X:83968967-83968989 CCTGGCAGGGTGGGGGTGGGTGG - Intergenic
1199429233 X:147740309-147740331 CATTCAAGGGTGAGGATGGCAGG - Intergenic
1202589290 Y:26465651-26465673 CCTGGAAGGGTGGGGGCAGCAGG - Intergenic