ID: 930022736

View in Genome Browser
Species Human (GRCh38)
Location 2:47011386-47011408
Sequence CGCGGCCATCAGGGGCACGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930022736_930022745 4 Left 930022736 2:47011386-47011408 CCACCGTGCCCCTGATGGCCGCG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 930022745 2:47011413-47011435 TCTGCATCGGGTCCCTTCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 53
930022736_930022750 22 Left 930022736 2:47011386-47011408 CCACCGTGCCCCTGATGGCCGCG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 930022750 2:47011431-47011453 GCTGGGTGAGTGAGCTGTGAGGG 0: 1
1: 0
2: 5
3: 30
4: 324
930022736_930022751 26 Left 930022736 2:47011386-47011408 CCACCGTGCCCCTGATGGCCGCG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 930022751 2:47011435-47011457 GGTGAGTGAGCTGTGAGGGCAGG 0: 1
1: 0
2: 0
3: 57
4: 426
930022736_930022749 21 Left 930022736 2:47011386-47011408 CCACCGTGCCCCTGATGGCCGCG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 930022749 2:47011430-47011452 CGCTGGGTGAGTGAGCTGTGAGG 0: 1
1: 0
2: 3
3: 18
4: 216
930022736_930022746 5 Left 930022736 2:47011386-47011408 CCACCGTGCCCCTGATGGCCGCG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 930022746 2:47011414-47011436 CTGCATCGGGTCCCTTCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 80
930022736_930022742 -9 Left 930022736 2:47011386-47011408 CCACCGTGCCCCTGATGGCCGCG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 930022742 2:47011400-47011422 ATGGCCGCGAAGGTCTGCATCGG 0: 1
1: 0
2: 0
3: 2
4: 31
930022736_930022743 -8 Left 930022736 2:47011386-47011408 CCACCGTGCCCCTGATGGCCGCG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 930022743 2:47011401-47011423 TGGCCGCGAAGGTCTGCATCGGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930022736 Original CRISPR CGCGGCCATCAGGGGCACGG TGG (reversed) Exonic
900174417 1:1285477-1285499 TGCAGCCATCAGGGGCAAGAAGG + Intronic
901054061 1:6440510-6440532 CGGGGCCATCAGGGGTGGGGCGG + Intronic
904013987 1:27406414-27406436 AGCGGCCAGCAAGGGCACAGAGG + Exonic
905265699 1:36753095-36753117 AGCTGCCCTCCGGGGCACGGTGG - Intergenic
909012903 1:70354409-70354431 CGCCGCCGCCAGGGGCAAGGGGG + Exonic
911664607 1:100539086-100539108 CCTGGCCATCGGGGGCACGCTGG + Exonic
914992638 1:152511893-152511915 CTGGGCCATGAGGAGCACGGAGG + Exonic
918355957 1:183706723-183706745 CTCTGCCATCAGGGGCTCTGTGG - Intronic
924816696 1:247448198-247448220 CGCGGCCATCTTGGTCTCGGCGG + Intronic
1067830917 10:49610604-49610626 CGCGGCCACCTGAGGCACAGGGG + Exonic
1072100411 10:92224185-92224207 AGCAACAATCAGGGGCACGGTGG - Intronic
1076821094 10:132939985-132940007 CAGGGCCCTCAGGGGCACTGTGG - Intronic
1077492750 11:2869761-2869783 CGCGGCCTGCACGGGCACGACGG - Intergenic
1079240736 11:18720785-18720807 GGTGGCCATCAGGGGGACTGGGG + Intronic
1083763786 11:64832717-64832739 CGCGGCCCTCAGGTGTCCGGCGG - Exonic
1084675079 11:70629516-70629538 TGCGGCCCCCAGGGTCACGGTGG - Intronic
1084704927 11:70810580-70810602 GGCGGCCATCATGGGCTCTGTGG + Intronic
1087891597 11:103543033-103543055 CCCTGCCTTCAGGGGCACTGGGG + Intergenic
1092281350 12:7099979-7100001 CGAGGCCAGCAGGGGCTCTGAGG - Exonic
1094048664 12:26195694-26195716 CGCGGCCAGCAGAGGCAGGGGGG + Exonic
1096251089 12:50033034-50033056 CGCGGGCGTCGGGGGCAGGGAGG + Intronic
1096533778 12:52258166-52258188 CGCGGCCTTCATGGACAAGGTGG - Intronic
1103899321 12:124295262-124295284 CGCGGGGATCCGGGGCGCGGGGG + Intronic
1104792780 12:131494163-131494185 CGCGGGCATCAGGAGCACGAGGG + Intergenic
1110132190 13:72022311-72022333 CCCTGCCTTCAGGGGCACTGGGG - Intergenic
1120881307 14:89417034-89417056 CGCGGGCGGCAGGGGCGCGGGGG + Intronic
1122261798 14:100527789-100527811 TGTGGCCATCAGAGGCACAGAGG - Intronic
1122707334 14:103629473-103629495 CGCGGCCCTCAGGAGCAAGGCGG + Intronic
1122901013 14:104782378-104782400 CGGGGCCATGCTGGGCACGGTGG - Intronic
1122905614 14:104800371-104800393 CGCAGCCAGCAGGGGCGCTGGGG - Intergenic
1123423190 15:20148015-20148037 GGCGGACAGCAGCGGCACGGCGG + Intergenic
1123532416 15:21154554-21154576 GGCGGACAGCAGCGGCACGGCGG + Intergenic
1129709396 15:77812823-77812845 CACAGCCATCAGGGACAGGGAGG + Intronic
1132806679 16:1778199-1778221 AGCGGCCATCCGGGGCACCAAGG - Exonic
1133115588 16:3576374-3576396 CGAGGTCATGAGGGGCAGGGAGG - Intronic
1135421200 16:22306870-22306892 GGAGGCCTTCACGGGCACGGAGG + Intronic
1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG + Exonic
1141833340 16:86522035-86522057 CCCTGCCCACAGGGGCACGGTGG + Intergenic
1142073213 16:88102796-88102818 GGCGGCGATCAGGGGCCCTGCGG - Intronic
1142304929 16:89279719-89279741 CGGGGCCGTCAGGGGCACAGAGG + Exonic
1142552142 17:747389-747411 CATGGCCAACAGGGGCATGGTGG + Exonic
1142828879 17:2532575-2532597 CGCGGCCAGAATGGGCACCGAGG + Intergenic
1143090562 17:4447056-4447078 CGGCGCCATTAGGGGGACGGGGG + Intronic
1143582843 17:7836466-7836488 GGCGGCCGGCTGGGGCACGGGGG + Intergenic
1148551329 17:48552217-48552239 CGGGGCCGACAGGGGCTCGGGGG + Exonic
1152139873 17:78530008-78530030 GGCGGCCATCAGGGCCATGATGG - Intronic
1152625480 17:81386344-81386366 CGTGGGCATCGGGGGCATGGTGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1160411391 18:78677693-78677715 CGGGTTCACCAGGGGCACGGAGG + Intergenic
1160692864 19:467826-467848 CGGGGCCAAGAGGGGCACTGAGG - Intronic
1160909599 19:1468593-1468615 CGGGGCCTGCAGGGGAACGGGGG - Exonic
1161071924 19:2266723-2266745 GGCGGCCATCAGAGGCAGGCAGG + Intronic
1161224406 19:3136393-3136415 CCTGGCCAGCAGGGGCCCGGGGG + Exonic
1161333864 19:3700545-3700567 CGCGGCCAATCGGGGCTCGGGGG + Intergenic
1161769558 19:6223876-6223898 AGCGGCCAGCAGGTGCACGGCGG + Intronic
1162808184 19:13149896-13149918 CGCTGCGGGCAGGGGCACGGCGG + Exonic
1162914014 19:13865028-13865050 CGGGGGAATCAGGGACACGGGGG - Intronic
1163156103 19:15440627-15440649 CCCGGCCATCAGGGGTACCTGGG + Intronic
1166367488 19:42284715-42284737 CGCGGGCATCAGGGGCCTGTGGG - Exonic
930022736 2:47011386-47011408 CGCGGCCATCAGGGGCACGGTGG - Exonic
937882869 2:126881734-126881756 TGCACACATCAGGGGCACGGAGG - Intergenic
946386633 2:219387862-219387884 CGCGGCCTGAAGGGGCACGCGGG - Exonic
947982986 2:234425921-234425943 CGCAGCCCTCAGGGGCATGCGGG + Intergenic
948918776 2:241051862-241051884 TGCGGCCCCCAGGGGCAGGGGGG + Intronic
1171034221 20:21703347-21703369 GGCGGCCTTCACGGGGACGGGGG + Intergenic
1175168837 20:57065614-57065636 AGGGGCCATCTGGGGCATGGTGG - Intergenic
1176161695 20:63651968-63651990 CGCTGCCCTCAGGGGCAGGAGGG + Intronic
1176372307 21:6069427-6069449 CGCAGCCATCAGAGGCCTGGAGG - Intergenic
1179751211 21:43469112-43469134 CGCAGCCATCAGAGGCCTGGAGG + Intergenic
1180059818 21:45379084-45379106 CGCTCCCATCAGGGCCAAGGTGG + Intergenic
1180059833 21:45379146-45379168 CGCTCCCATCAGGGCCAAGGTGG + Intergenic
1180059848 21:45379208-45379230 CGCTCCCATCAGGGCCAAGGTGG + Intergenic
1180059863 21:45379270-45379292 CGCTCCCATCAGGGCCACGGTGG + Intergenic
1180622560 22:17171740-17171762 CGCAGCCACCCGGGGCCCGGGGG + Intergenic
1182347061 22:29673739-29673761 CACGGCCATCAGAGGGACAGGGG - Intronic
1184032811 22:41904879-41904901 TCCTGCCATCAGGCGCACGGTGG - Exonic
955340791 3:58123544-58123566 GCCGGCCGTCAGGGGCACGTAGG - Exonic
962708040 3:138063577-138063599 GGTGGCCAGCAGGGGCACTGAGG - Intronic
968661504 4:1800639-1800661 CACGCCCATCAGGGGCACTGAGG - Intronic
968830497 4:2931065-2931087 AGCGGCCACCAGGGGCCCCGCGG + Exonic
983792240 4:171813056-171813078 CGCGGCGAGCCGGGGCGCGGCGG - Intronic
988447543 5:31304752-31304774 GGGGGCCATCAGGGGCAAGTTGG - Intronic
995042956 5:107609790-107609812 GGCGGCGGGCAGGGGCACGGTGG - Intronic
998372613 5:141671286-141671308 AGCTGCCATCAGGGGCTGGGGGG + Exonic
1001065179 5:168529975-168529997 CGCGGCCATCCTGGGCGGGGTGG + Exonic
1001907414 5:175484479-175484501 CGGGGCCAGCAGGTGCACGCCGG + Intronic
1002297724 5:178240613-178240635 CGGGGACAGCAGGGGCAGGGTGG - Intronic
1002526246 5:179817413-179817435 CTGGGCCCTCAGGGGCACTGAGG - Intronic
1007596153 6:43052628-43052650 CGTGGCGATGAGGGGGACGGGGG - Exonic
1015939065 6:138431135-138431157 CGTGGTTATCAGGGGCATGGGGG + Exonic
1016658087 6:146543784-146543806 CGCGGCCGCCGGGGGCGCGGCGG + Exonic
1019667360 7:2258550-2258572 CACGCCCAGGAGGGGCACGGAGG + Intronic
1024672203 7:51606633-51606655 CACAGCCAACAGGGGCACCGGGG - Intergenic
1029207580 7:98878680-98878702 CGCGGCCCTCAGGCGCGGGGAGG + Intronic
1040907875 8:52487370-52487392 CGGGGCCATCAAGGTCACTGTGG - Intergenic
1061290692 9:129649037-129649059 CCCGGCCATCAGAAGCACAGAGG - Intergenic
1061519901 9:131111851-131111873 CGGGGCCCGCAGGGGCAGGGAGG - Intronic
1203772386 EBV:56203-56225 GGCGGACATCAGGGACAAGGTGG - Intergenic
1190136937 X:47806527-47806549 AGCGGCCAGCAAGGGCACAGAGG - Intergenic
1197607839 X:128606484-128606506 CGCGGCCAGAGTGGGCACGGAGG - Intergenic
1201798229 Y:17924919-17924941 CTCGACCATCAGAGGCAAGGTGG + Intergenic
1201803324 Y:17981038-17981060 CTCGACCATCAGAGGCAAGGTGG - Intergenic