ID: 930023360

View in Genome Browser
Species Human (GRCh38)
Location 2:47014698-47014720
Sequence GGCTCACGTCAGCCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 237}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930023351_930023360 27 Left 930023351 2:47014648-47014670 CCCAAAAGGCGGCTCACACCCCC 0: 1
1: 0
2: 0
3: 16
4: 103
Right 930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
930023355_930023360 7 Left 930023355 2:47014668-47014690 CCCTTCGTCTCCTGCCTTCGCAG 0: 1
1: 0
2: 0
3: 13
4: 186
Right 930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
930023353_930023360 9 Left 930023353 2:47014666-47014688 CCCCCTTCGTCTCCTGCCTTCGC 0: 1
1: 0
2: 1
3: 33
4: 358
Right 930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
930023358_930023360 -3 Left 930023358 2:47014678-47014700 CCTGCCTTCGCAGTTATTCTGGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
930023352_930023360 26 Left 930023352 2:47014649-47014671 CCAAAAGGCGGCTCACACCCCCT 0: 1
1: 0
2: 0
3: 14
4: 96
Right 930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
930023356_930023360 6 Left 930023356 2:47014669-47014691 CCTTCGTCTCCTGCCTTCGCAGT 0: 1
1: 0
2: 1
3: 12
4: 145
Right 930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
930023354_930023360 8 Left 930023354 2:47014667-47014689 CCCCTTCGTCTCCTGCCTTCGCA 0: 1
1: 0
2: 0
3: 13
4: 265
Right 930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
930023359_930023360 -7 Left 930023359 2:47014682-47014704 CCTTCGCAGTTATTCTGGCTCAC 0: 1
1: 0
2: 0
3: 7
4: 61
Right 930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930023360 Original CRISPR GGCTCACGTCAGCCCCCAGC AGG Intronic
900381269 1:2385222-2385244 GCCTGTCGTCGGCCCCCAGCTGG - Intronic
900625470 1:3606573-3606595 GGCTCCCGACAGCCCTCAGGAGG + Intronic
901811174 1:11767408-11767430 GGCTCCCTTCATCCCCCAGCAGG - Intronic
902255846 1:15188165-15188187 GGCTCGCGTTAGCTCCCTGCTGG + Intronic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
902747317 1:18482460-18482482 GGCACACGTCAGCCACCACCAGG - Exonic
903534862 1:24060234-24060256 GGCGCCCCTCAGCCCCCTGCAGG + Intronic
903917481 1:26774872-26774894 GGCACACGCCAGCCCCCATATGG + Exonic
906686561 1:47766940-47766962 GGCTCAGGTCAGCTTCCAGTTGG - Intronic
911149019 1:94579669-94579691 GGATCCCTTCAGCCCCCAGTTGG + Intergenic
912330532 1:108816540-108816562 GGGTGAGGTCAGCCGCCAGCTGG + Intronic
912385186 1:109267997-109268019 GGCCCACGAGAGCACCCAGCGGG + Exonic
913088749 1:115461758-115461780 GGCTCACCTCACCCCTCTGCTGG - Intergenic
914171821 1:145232854-145232876 GGCTCCCGCCCGCTCCCAGCCGG + Intergenic
914944633 1:152053114-152053136 GGCTCACTGCAGCCTCCACCAGG - Intergenic
916751035 1:167722536-167722558 GGCTCACCGCAGCCGCCCGCCGG - Intronic
917341939 1:173989098-173989120 GGCTCACTGCAGCCTCCATCAGG + Intronic
917659711 1:177164986-177165008 GAATCAGGTCAGCCCCCAGCTGG + Intergenic
920552953 1:206880175-206880197 GAATCACCTCAGCCCCCAGGAGG - Intergenic
1063632787 10:7749709-7749731 GGCTCACTTCAGCCTCAAGCTGG + Intergenic
1067234808 10:44438584-44438606 GCCTGACGTCAGCGCCCTGCAGG + Intergenic
1071853143 10:89595743-89595765 GGCTCACTACAGCCTCCACCAGG - Intronic
1073073708 10:100810322-100810344 GGCTCTCCTAAGCCCCCAGGTGG - Intronic
1075447979 10:122526900-122526922 GACTCACATCAGAGCCCAGCTGG - Intergenic
1075508714 10:123051066-123051088 GGCTCACGTGGCCACCCAGCTGG + Exonic
1075925097 10:126245261-126245283 GGTTCACGTCAGGTCCCACCTGG - Intronic
1076387027 10:130064788-130064810 GGCTCACGGCAATCCCCACCAGG + Intergenic
1076503784 10:130958143-130958165 GGCCCCCATCAGCCCCCCGCTGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077210485 11:1369002-1369024 AGCCCACGTCAGCTCCCAGCAGG - Intergenic
1077273344 11:1692040-1692062 GGTTCACTTCTGCCCCCAGCTGG + Intergenic
1084410531 11:69003823-69003845 GCCTCTGGTCAGCCCCCAGAAGG - Intergenic
1084650598 11:70487079-70487101 GGCTTTCGTCAGGCCGCAGCTGG + Intronic
1084692929 11:70737410-70737432 GGGACACGCCAGCCCCCAGGTGG + Intronic
1084760223 11:71266158-71266180 GGATGACGGCAGGCCCCAGCAGG - Intergenic
1086566353 11:88231147-88231169 GTCTCACAGCAGCCCACAGCAGG + Intergenic
1087060214 11:93970154-93970176 ACCTGACGCCAGCCCCCAGCGGG - Intergenic
1088213086 11:107477767-107477789 AGCTCACTTCAGTCCCAAGCAGG - Intergenic
1202806151 11_KI270721v1_random:6693-6715 GGCTCGCGTCAACCCTGAGCTGG - Intergenic
1091973674 12:4809221-4809243 GGCTCGCGGCAGCCCCTGGCTGG + Exonic
1094021104 12:25915368-25915390 GGCTCACTTAAACCCCCAGGAGG - Intergenic
1094376874 12:29800046-29800068 GCCTCACCACAGCCCCCAGAAGG - Intergenic
1097226148 12:57477787-57477809 GGGTCACCTCAGCCCAGAGCTGG - Intronic
1097386075 12:58950901-58950923 AGCTCACTGCAGCCCCTAGCAGG - Intergenic
1102265861 12:111484347-111484369 GGTTCAAGTCATCCTCCAGCTGG + Intronic
1102866828 12:116381410-116381432 GGCTCAGGGCAGCAGCCAGCTGG + Intergenic
1102953657 12:117046115-117046137 GGCTCTTGTCAGCCCCCAATAGG + Intronic
1103008517 12:117439908-117439930 GGCTCAGGTTTCCCCCCAGCTGG + Intronic
1105033940 12:132904808-132904830 GCCTCAAGTCATCCCCAAGCCGG + Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1110217866 13:73043274-73043296 GGCTCACTGCAACCCCCACCAGG - Intergenic
1110971908 13:81774503-81774525 GGCTCACTTCAGCCTCCTCCTGG + Intergenic
1111116120 13:83779897-83779919 TGCTCATGCCAGCCCCCAGAGGG - Intergenic
1112092845 13:96100528-96100550 AGCTCCTGTCAGCCACCAGCAGG - Intronic
1112308993 13:98301179-98301201 AGCTCATGCCAGCCCCCACCTGG + Intronic
1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1117406748 14:55411655-55411677 GGCGCAGGTCAGCCGCCGGCGGG + Exonic
1119159531 14:72441561-72441583 GGCCCTCGCCAGCCCTCAGCAGG + Intronic
1120747875 14:88168189-88168211 CACTCACGCCAGCCCCCATCAGG - Intergenic
1122166432 14:99827870-99827892 GGGTCCCGTGAGCACCCAGCAGG + Intronic
1122263918 14:100538052-100538074 CGCCCGCCTCAGCCCCCAGCAGG - Exonic
1122635869 14:103129418-103129440 GGCTCCCATCAGCTCCCCGCTGG - Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202849684 14_GL000225v1_random:8991-9013 GGCTCACGAAATCCCCCAGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1124423039 15:29539026-29539048 GACTGAAGTCAGTCCCCAGCAGG - Intronic
1125473156 15:40024290-40024312 TTCTCACCTCAGCCTCCAGCTGG + Intronic
1126766747 15:52018100-52018122 GGCTCACTGCAACCCCCCGCGGG + Intronic
1127165691 15:56243549-56243571 GGCGCCCCTCAGCCCCCCGCTGG + Intergenic
1129333639 15:74840045-74840067 GCCTCAGGTCAGCCCACAGCTGG - Intronic
1133209948 16:4258010-4258032 GGCTCCCTCCAGCCCCCAGAAGG + Exonic
1136347518 16:29685643-29685665 GGGTCACTTCAGCCACCAACTGG - Intronic
1138196170 16:55053878-55053900 AGCTCAGACCAGCCCCCAGCTGG - Intergenic
1138198820 16:55074032-55074054 AGCTCACGGCAGCCTCAAGCTGG - Intergenic
1139209461 16:65062900-65062922 GGCTCACGTCAGCCCCTCTGTGG - Intronic
1139958347 16:70703995-70704017 GGCTCACACCAGCCCCTGGCAGG - Intronic
1141529164 16:84634308-84634330 GGCTGACCTCAGCCCGAAGCAGG + Intergenic
1141618983 16:85226698-85226720 GGCTCAGGCCACCTCCCAGCAGG - Intergenic
1142287290 16:89176625-89176647 GGCTCACGGGACTCCCCAGCCGG - Intronic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142780670 17:2178981-2179003 GGCTCCAGTCTGACCCCAGCAGG - Intronic
1143012473 17:3873476-3873498 TGCTCACATCAGTCCCCAACAGG + Intronic
1143107295 17:4536135-4536157 GGCTCCCGGCGTCCCCCAGCAGG - Exonic
1143846055 17:9773337-9773359 GGCTCACTGCAGCCACCAGCTGG - Intronic
1144079220 17:11747460-11747482 GTCTCACTTCAGACACCAGCTGG + Intronic
1144312138 17:14023743-14023765 GGCAGACGTCAGTCCCCAGGTGG + Intergenic
1144332622 17:14237576-14237598 GGCAGACGTCAGTCCCCAGGTGG - Intergenic
1144964843 17:19070461-19070483 ATCTCAAGGCAGCCCCCAGCGGG + Intergenic
1144983124 17:19181717-19181739 ATCTCAAGGCAGCCCCCAGCGGG - Intergenic
1144985101 17:19196522-19196544 ATCTCAAGGCAGCCCCCAGCGGG + Intergenic
1146138137 17:30341055-30341077 GGCTCAGGAAAGCTCCCAGCAGG - Intergenic
1148125793 17:45236135-45236157 GGCTGACCCCAGCCCACAGCAGG + Exonic
1148378362 17:47171024-47171046 GGCTCACTGCAGTCCCCATCTGG - Intronic
1148700202 17:49582418-49582440 GGCCCCCGGCAGCCCCCAGCTGG - Intronic
1149295648 17:55259958-55259980 GCCTCACGTCTGCCCCCACCGGG + Intergenic
1150225912 17:63524317-63524339 TGCACTCCTCAGCCCCCAGCAGG - Exonic
1152304085 17:79511144-79511166 GGCTCACGGGAGCCTCCACCTGG + Intronic
1152403873 17:80085552-80085574 GGCTCAAGTTAGCTCTCAGCAGG - Intronic
1152419420 17:80184076-80184098 GGCTGTGGTCAGCCTCCAGCTGG - Exonic
1152587983 17:81197570-81197592 GTCTCTCGCCAGCCCCCACCCGG - Intronic
1152684725 17:81688392-81688414 GGTTCCCGTCAGCCTCCAACAGG - Intronic
1152740025 17:82014742-82014764 GGCCCACGTCAACCCCCACGGGG - Intronic
1152865348 17:82719255-82719277 CCCTCACACCAGCCCCCAGCTGG + Intronic
1157575182 18:48738787-48738809 GGCTCAGCTCATCACCCAGCGGG - Intronic
1160245628 18:77156564-77156586 TGCACGCCTCAGCCCCCAGCCGG - Intergenic
1160297953 18:77654969-77654991 GGCTCTCCTGAGCCCCCAGAAGG + Intergenic
1160658551 19:287628-287650 GGCTCACGGCAGCCCCAAACAGG + Exonic
1160709218 19:543220-543242 GGCTCACTGCAGCCCCAACCTGG + Intergenic
1161528075 19:4769697-4769719 GGCTCAGGACAGTTCCCAGCGGG + Intergenic
1161628196 19:5338965-5338987 GGCTCCCGTCCGCCACCACCCGG - Intronic
1163400987 19:17092271-17092293 GGCTCAGTGCAGCTCCCAGCTGG - Intronic
1163664116 19:18595096-18595118 GGCTGCAGCCAGCCCCCAGCAGG + Intronic
1163752741 19:19087852-19087874 GGCTCAAGTGAGCCCACAGGAGG + Intronic
1164783870 19:30914013-30914035 GGTTCACGTCAGCCAGGAGCAGG - Intergenic
1166258747 19:41623694-41623716 GGCTCCCATAAACCCCCAGCAGG + Intronic
1167492324 19:49799878-49799900 GGCTCACCACTGCCCCCATCTGG - Intronic
1167593790 19:50417390-50417412 GGCTCAGGACAGCTCACAGCTGG - Intronic
925238436 2:2299325-2299347 GGCCCATGTGAGCCGCCAGCAGG + Intronic
926694956 2:15764706-15764728 CACTGACGACAGCCCCCAGCAGG - Intergenic
927243040 2:20935333-20935355 GCCTCACCTCAGCCCACCGCAGG + Intergenic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
930025573 2:47027263-47027285 GGCGCACGGCAGGGCCCAGCTGG - Intronic
932321736 2:70827458-70827480 GGCTCCAGGTAGCCCCCAGCAGG - Intergenic
933288554 2:80411003-80411025 GGCTCACCTCTGCCACCACCTGG + Intronic
933770641 2:85741860-85741882 GCCGAAGGTCAGCCCCCAGCTGG - Intergenic
934746194 2:96761107-96761129 GGGCCAGGGCAGCCCCCAGCAGG + Exonic
948735586 2:240002626-240002648 GGGTCAGGTCAGCCCTTAGCTGG - Intronic
1170876066 20:20251366-20251388 GGCTTAGGTCAGCCCACAACTGG - Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1172751128 20:37252038-37252060 GGCTCTCATCAGGCCCCAGTAGG - Intronic
1172979897 20:38933080-38933102 TGCTCATGTCAGCCCCAAGCAGG + Intronic
1173400144 20:42718890-42718912 GGCTCTCGTCAGCTCTCAACTGG - Intronic
1174564018 20:51451821-51451843 GTCTCCCGTCAACCCCCAGATGG + Intronic
1175171766 20:57085964-57085986 GCCTCAGGGCAGCCCCAAGCTGG + Intergenic
1175778630 20:61668471-61668493 GCCCCACGACAGCCTCCAGCAGG - Intronic
1175992714 20:62797369-62797391 AGCTCACTGCAGACCCCAGCAGG - Intronic
1176207159 20:63895355-63895377 GGCCCACGTCAGGCCCGGGCAGG + Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1181509293 22:23381856-23381878 GGCACACCTCAGCCCCTGGCAGG + Intergenic
1181589797 22:23877001-23877023 GAGGCACGTCAGCCACCAGCTGG - Intronic
1181837993 22:25626805-25626827 GGCTATCGTCTGCCCCCAGTGGG + Intronic
1183272659 22:36871789-36871811 GGCACACAGCAGCACCCAGCAGG - Intronic
1183582340 22:38733440-38733462 GGATCCAGTCAGCCCCCTGCTGG - Exonic
1184339299 22:43877257-43877279 GCCTCACATCAGCCCCCGGGTGG - Intergenic
1184912787 22:47547432-47547454 GGCCCACATCAGACCCCAGCTGG - Intergenic
1185074501 22:48676080-48676102 GGCTGATCTCAGCCCCCAGAGGG + Intronic
951984855 3:28607736-28607758 GGCTCACCGCAACCTCCAGCGGG + Intergenic
954202034 3:49029173-49029195 GGCTCTCGGAAGCCCCCATCTGG + Intronic
954648425 3:52145249-52145271 GGCTCATGTCAGGCTCCAGGTGG - Intronic
955093911 3:55778019-55778041 GGATCATGTCAGCCAACAGCAGG - Intronic
955688230 3:61564900-61564922 GGCTAACTCCAGCCCCCAGCGGG - Intronic
959436066 3:106316898-106316920 AGCTCACTGCAGCCCCTAGCAGG + Intergenic
964525647 3:157613312-157613334 GGCACAGGTCAGCTCCCAGAGGG - Intronic
968428392 4:537799-537821 GCCTCACCTCAGCCCCCCACCGG - Intronic
968483225 4:846101-846123 GGATCTAGTCACCCCCCAGCAGG - Intergenic
969443754 4:7232718-7232740 GGCCCAGGGCAGCTCCCAGCAGG - Intronic
969490253 4:7495620-7495642 GGCTCATGTCATCTCACAGCTGG + Intronic
976245649 4:83003611-83003633 GGATCACTTGAGCCCCCAGGTGG - Intronic
977547979 4:98408178-98408200 GGCTCACTGCAGCCTCCACCTGG + Intronic
984277810 4:177631485-177631507 GGCTCACTGCAGCCTCCACCTGG + Intergenic
984544066 4:181077904-181077926 GGCTCACTCCAGGCCCCAGATGG - Intergenic
985010897 4:185580967-185580989 GGCTCAGATCAGCCCAGAGCAGG - Intergenic
985270555 4:188190608-188190630 GGCTCACGTCATCCAACAGAAGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985573696 5:664007-664029 GGCTCTGCTCAGCCCCCTGCTGG + Exonic
986098601 5:4584722-4584744 GGATCAGGTCAGCACCAAGCAGG + Intergenic
986165411 5:5268301-5268323 GCCTCACGTCAGCCTCCTTCAGG + Intronic
997479855 5:134176878-134176900 GGCTCTCGTCAGCCTCCCGCCGG - Exonic
1001240862 5:170068941-170068963 GGCTCAGATCAGCACCCAGTGGG - Intronic
1001587654 5:172844449-172844471 GGCTATCGTCAGCCCTCAGAAGG - Intronic
1005742973 6:28809957-28809979 GCCTCACGTCTCTCCCCAGCTGG + Intergenic
1006135485 6:31893390-31893412 GGCTCACTTCAGCCTCGAACTGG + Intronic
1007547771 6:42707470-42707492 CCCCCACCTCAGCCCCCAGCAGG - Intronic
1012252836 6:96997665-96997687 GGCTCACTACAGCCTCCACCTGG - Intronic
1013231605 6:108165963-108165985 GGCTGACGTCAGACCCCGCCAGG + Intergenic
1013312431 6:108908340-108908362 GGCCATGGTCAGCCCCCAGCTGG - Intronic
1017098193 6:150823970-150823992 GGCTCACGTGAGCACCGGGCAGG - Intronic
1018758137 6:166867153-166867175 TGCTCACCTCATCCCCCAGCTGG - Intronic
1019700758 7:2474208-2474230 GGCTCACGTCTCCCTCCAGGTGG + Intergenic
1021593009 7:22285046-22285068 CGCTCACATCAGCCTACAGCTGG + Intronic
1024088612 7:45917757-45917779 GGCTCAGGTCTGCCCCCTGCCGG - Intronic
1024733058 7:52274072-52274094 GGTCTACGGCAGCCCCCAGCCGG + Intergenic
1025033007 7:55572449-55572471 GGCTCCCGCCCGCTCCCAGCCGG - Exonic
1025983073 7:66423917-66423939 AGCTCTCGTCAGCCTCCTGCTGG - Intergenic
1027132277 7:75599393-75599415 TGCCCACCTCTGCCCCCAGCTGG - Intronic
1028532401 7:91852023-91852045 CACACACATCAGCCCCCAGCTGG - Intronic
1029683348 7:102128080-102128102 GGCCCACTTCAGCCTCCAGAAGG + Intronic
1031406815 7:121396221-121396243 GGCTCCCGTCGGCCTCCGGCAGG - Exonic
1032949079 7:136886781-136886803 GGATCATTTGAGCCCCCAGCAGG + Intronic
1034995523 7:155574793-155574815 CACTCACATCAGCCCACAGCTGG - Intergenic
1035203383 7:157280145-157280167 GGCCCACCTCAGCCCCCGCCGGG - Intergenic
1036640965 8:10583488-10583510 GGCTTACGTCCACCCCCAACAGG + Intergenic
1039009358 8:33075731-33075753 GGCTCACATCTCACCCCAGCTGG + Intergenic
1041333169 8:56750582-56750604 GGGCCACTTCAGCCCACAGCAGG + Intergenic
1049073113 8:140372413-140372435 GGCCCTCGTCAGCCCTCATCTGG + Intronic
1049789731 8:144467062-144467084 AGCTCTCTTCCGCCCCCAGCTGG - Exonic
1051528669 9:18075825-18075847 GGCACAGGTCTGCCCACAGCAGG - Intergenic
1052824621 9:33166352-33166374 GCCTCACGTCAGTCCCCAAAAGG + Intronic
1053001733 9:34580462-34580484 GTCCCCCCTCAGCCCCCAGCCGG + Intronic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057619113 9:96619442-96619464 GGCTCCCGCCAGCCCCGCGCGGG + Exonic
1059886315 9:118748832-118748854 GAGTCACCTCATCCCCCAGCAGG + Intergenic
1059982795 9:119791819-119791841 GCCTCACGTAATCCCCCCGCTGG - Intergenic
1060566548 9:124597912-124597934 GGCTCACTGCAGCCTCCACCAGG + Intronic
1061510508 9:131058188-131058210 GGCTCACTGCAGCCTCCTGCTGG + Intronic
1061800183 9:133109396-133109418 GGCTCGGGGCAGCCCCCGGCGGG - Intronic
1061825816 9:133257606-133257628 GGCACACGGCCGCCCCCACCTGG + Intronic
1062043521 9:134414950-134414972 GGCTCCGGTCAGCCCCCACATGG - Intronic
1062235110 9:135504100-135504122 GGCTCATGTCAGCCCCAGGAGGG - Exonic
1062406475 9:136399235-136399257 GGCCCCAGTCAGCCTCCAGCAGG - Intergenic
1062443914 9:136585472-136585494 GGGTCACGTAAGCCACCAGAGGG + Intergenic
1062629102 9:137455694-137455716 GCCTCCCCTCAGCCCCCACCCGG + Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG + Intergenic
1187802123 X:23075635-23075657 GGCTCCCGTCGGCCTCCGGCAGG + Intergenic
1189292098 X:39893968-39893990 GGCAGACCTCAGCCACCAGCTGG + Intergenic
1190874967 X:54453262-54453284 GACTCACTTCATCCCCCAGGAGG + Intronic
1195903091 X:109818678-109818700 GTCTCTCATCAGCCACCAGCTGG + Intergenic
1197781860 X:130167669-130167691 GGCTCACTGCAGCCTCCACCTGG - Intergenic
1199749082 X:150797968-150797990 GGCTCACTGCAGCCTCCACCTGG - Intronic
1200150186 X:153947464-153947486 GGCTCACGGGAGCCCCCTGGAGG - Intergenic
1200479499 Y:3682698-3682720 GGCTCCCGTCCTCCCCCACCCGG + Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201783242 Y:17745553-17745575 GGCTCAGGACAGGCCCAAGCAGG - Intergenic
1201818311 Y:18160434-18160456 GGCTCAGGACAGGCCCAAGCAGG + Intergenic