ID: 930025357

View in Genome Browser
Species Human (GRCh38)
Location 2:47026096-47026118
Sequence GACCTCATTTTGGCAGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930025353_930025357 -8 Left 930025353 2:47026081-47026103 CCCAGTTTCCTTGGAGACCTCAT 0: 1
1: 0
2: 2
3: 17
4: 183
Right 930025357 2:47026096-47026118 GACCTCATTTTGGCAGCCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
930025352_930025357 -1 Left 930025352 2:47026074-47026096 CCTAGGGCCCAGTTTCCTTGGAG 0: 1
1: 0
2: 2
3: 24
4: 242
Right 930025357 2:47026096-47026118 GACCTCATTTTGGCAGCCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
930025350_930025357 8 Left 930025350 2:47026065-47026087 CCAGTGGAGCCTAGGGCCCAGTT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 930025357 2:47026096-47026118 GACCTCATTTTGGCAGCCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
930025354_930025357 -9 Left 930025354 2:47026082-47026104 CCAGTTTCCTTGGAGACCTCATT 0: 1
1: 0
2: 1
3: 51
4: 274
Right 930025357 2:47026096-47026118 GACCTCATTTTGGCAGCCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
930025347_930025357 17 Left 930025347 2:47026056-47026078 CCAGCGGAGCCAGTGGAGCCTAG 0: 1
1: 0
2: 0
3: 5
4: 111
Right 930025357 2:47026096-47026118 GACCTCATTTTGGCAGCCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
930025346_930025357 22 Left 930025346 2:47026051-47026073 CCAGGCCAGCGGAGCCAGTGGAG 0: 1
1: 0
2: 5
3: 15
4: 210
Right 930025357 2:47026096-47026118 GACCTCATTTTGGCAGCCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930025357 Original CRISPR GACCTCATTTTGGCAGCCTC AGG Intronic
904821082 1:33244900-33244922 AACCTCATTTTATCAGCCTTGGG + Intergenic
905690624 1:39940201-39940223 TACCTCATAGTGGCATCCTCAGG - Intergenic
907454150 1:54564550-54564572 GACTTCCTTTCAGCAGCCTCTGG + Intronic
908767794 1:67569962-67569984 AAACACATTTTGGGAGCCTCTGG + Intergenic
910027200 1:82669810-82669832 GCACTTACTTTGGCAGCCTCTGG - Intergenic
911752358 1:101510546-101510568 GACTCCATTTTAGCAGCCTTCGG - Intergenic
912430149 1:109624603-109624625 GGCCACATTTTGGCAGCCCTGGG + Intronic
913034927 1:114955663-114955685 AATCTCACTTTGGGAGCCTCAGG + Intronic
916274894 1:162983135-162983157 GACCACATTTTGAGAGCCACTGG - Intergenic
917719510 1:177773616-177773638 CACCTTATTTTGTCAGTCTCAGG + Intergenic
918066489 1:181105288-181105310 GACCTCACTGGGGCAGCCGCGGG - Intergenic
920433721 1:205935229-205935251 GGCCTCCTTTTGGCATTCTCTGG + Intronic
920855840 1:209660924-209660946 GACATCATGGTGGCATCCTCTGG + Intergenic
921823654 1:219646882-219646904 AACCTCAGTTTCCCAGCCTCTGG - Intergenic
922866523 1:228865569-228865591 GACCTCATTTTGGGAGGCTGAGG + Intergenic
1063675805 10:8140068-8140090 GACCTCATTTTGAGAACCACTGG + Intergenic
1067473732 10:46553330-46553352 CTCCTCATTCTTGCAGCCTCAGG - Intronic
1067930389 10:50555039-50555061 GACCCCATTTGGGGAGGCTCTGG - Intronic
1071682052 10:87716180-87716202 GACCTCATCTTGGCTGCCCTAGG - Intronic
1077336231 11:2005904-2005926 GGCTTCCTTATGGCAGCCTCAGG - Intergenic
1079603306 11:22337829-22337851 GTTCTGATTTGGGCAGCCTCGGG - Intergenic
1079953032 11:26827792-26827814 GACCTCATGTTAGAAGCTTCTGG + Intergenic
1087640464 11:100750034-100750056 CACCCCCTTGTGGCAGCCTCAGG - Intronic
1087702005 11:101445394-101445416 GTCCTCATAATGTCAGCCTCAGG + Intergenic
1089789508 11:120932535-120932557 AGCCTCATTTTCACAGCCTCAGG + Intronic
1090207777 11:124895454-124895476 GACCTTTTTCCGGCAGCCTCAGG + Exonic
1202819215 11_KI270721v1_random:61086-61108 GGCTTCCTTATGGCAGCCTCAGG - Intergenic
1093356394 12:18173241-18173263 CACCTCCTTATGGCGGCCTCAGG + Intronic
1095649342 12:44588439-44588461 GACGTCATTTTGGCAGTCTGAGG - Intronic
1099747444 12:86723463-86723485 CTCCTGGTTTTGGCAGCCTCGGG + Intronic
1104308822 12:127635373-127635395 GGCCTCTTTCTGGGAGCCTCTGG - Intergenic
1104454635 12:128900980-128901002 GACCCCATTTTGGTAACCACTGG - Intronic
1106277908 13:28232182-28232204 ATCCTCATTTTTACAGCCTCCGG - Intronic
1108088565 13:46821538-46821560 GTCCTCACTTTTTCAGCCTCTGG + Intergenic
1109321120 13:60811159-60811181 GACCTCATTTGGTCAGCCTCAGG + Intergenic
1110065286 13:71096838-71096860 GTCCTCATCTTCGAAGCCTCAGG + Intergenic
1117179918 14:53181287-53181309 CACCCCCTTGTGGCAGCCTCAGG - Intergenic
1118713220 14:68539504-68539526 GAGCCTATTTTGGCAGCCTGTGG - Intronic
1119916647 14:78408234-78408256 ATCCTCATTTTGCCAGCCTCTGG + Intronic
1120038364 14:79724231-79724253 GACATCTTTTTGGCAGACTGTGG - Intronic
1121117436 14:91353511-91353533 GAGCTCCTTTTGTGAGCCTCTGG + Intronic
1125774698 15:42201668-42201690 GACCACATTTTGGGAGGCACTGG + Intronic
1126149810 15:45513742-45513764 AACCTCAGGTTGGCAGCCACTGG + Intronic
1130058811 15:80554636-80554658 AACCTCATTTTTTCAGCCACAGG + Intronic
1130616938 15:85419260-85419282 GATTTAATTATGGCAGCCTCAGG + Intronic
1131381308 15:91966062-91966084 CTCGTCATTTTGGCAGCCGCAGG + Intronic
1131879732 15:96850275-96850297 AACCTCTTTTTGCCAGTCTCAGG - Intergenic
1135954355 16:26943844-26943866 GATCTCATTTTGTCAGTTTCAGG + Intergenic
1137411395 16:48231338-48231360 GATCTCATTGTGGAAGCCTGAGG + Intronic
1138110214 16:54317745-54317767 GACCTCATTTTGGACATCTCTGG + Intergenic
1140958123 16:79886416-79886438 AACCTCATTCTAGAAGCCTCTGG + Intergenic
1141907438 16:87036555-87036577 GACCTCAGACTTGCAGCCTCCGG + Intergenic
1143444976 17:7002842-7002864 CACCTCATTTTTGCTGACTCTGG - Intronic
1144473888 17:15567576-15567598 GACCCCATTTTGGGAGGCTGGGG + Intronic
1147204289 17:38825467-38825489 GGTCTCATTTTGGCTGCTTCGGG + Exonic
1149236990 17:54603523-54603545 GCCCTCATGTTTGCAGTCTCAGG - Intergenic
1150637608 17:66926244-66926266 TACCTCATTTTTGCTGTCTCTGG - Intergenic
1156591262 18:38491294-38491316 GATCTCACTTTGGCAGGCCCAGG + Intergenic
1157844926 18:50994349-50994371 GAAATCATTCAGGCAGCCTCAGG + Intronic
1158562513 18:58526629-58526651 GACCTCAAGGTGGCACCCTCTGG - Intronic
1160038063 18:75319636-75319658 TACTTCATTATGGCAGCCACCGG - Intergenic
1161580653 19:5078889-5078911 GCCTTCACTGTGGCAGCCTCTGG - Intronic
1163664916 19:18598653-18598675 GACCTCACCATGGCAGCCTCAGG + Intronic
1166585730 19:43946747-43946769 GATCTCAATTTGACAGCCTAAGG - Intergenic
1167868192 19:52345182-52345204 CACCTGATTTTGGTATCCTCAGG - Intronic
927235323 2:20868440-20868462 GGCTGCAGTTTGGCAGCCTCTGG + Intergenic
930025357 2:47026096-47026118 GACCTCATTTTGGCAGCCTCAGG + Intronic
934832560 2:97545069-97545091 GACTTGATTTTGGCAGCTCCAGG - Intronic
935339327 2:102045837-102045859 GACCCCATGGTGGCTGCCTCTGG + Intergenic
935740539 2:106143700-106143722 GACCTCAGTCCTGCAGCCTCAGG - Intronic
936146039 2:109981184-109981206 GACCCCAGTGTGGGAGCCTCAGG - Intergenic
936198650 2:110390294-110390316 GACCCCAGTGTGGGAGCCTCAGG + Intergenic
937314610 2:120922992-120923014 GGCCTCTTTCTGGAAGCCTCAGG + Intronic
937411765 2:121682811-121682833 CGCCTCATTTCGGCAGCCTCAGG - Intergenic
938048514 2:128145254-128145276 CACCTCATTTTGGCAGCCCATGG + Intronic
938778861 2:134566311-134566333 AATCTCATTTTGGGAGCCTGAGG + Intronic
939330077 2:140746757-140746779 GACTTCATTTTGCCAGCTGCTGG - Intronic
944320284 2:198332511-198332533 AAACTTATTTTGGCAGTCTCTGG + Intronic
946097274 2:217286151-217286173 GACCTAAATTTGGCATCCTATGG - Intronic
946397678 2:219451471-219451493 GCCCTCATTTTGGGAAGCTCAGG - Intronic
948385702 2:237579297-237579319 GACTTTGTTTTGGCAGCCGCAGG - Intronic
948663103 2:239518769-239518791 GACCCCTTTTTGGTAGGCTCTGG - Intergenic
948859684 2:240746803-240746825 GACCGCAGGTAGGCAGCCTCAGG + Intronic
1172079883 20:32331736-32331758 GACCACATCTTTGGAGCCTCGGG + Exonic
1174626534 20:51919642-51919664 GGCCTCAGTTTGCCACCCTCTGG - Intergenic
1178045812 21:28693601-28693623 TACTTCATTTTGGCAGGCTGCGG - Intergenic
1181028150 22:20137410-20137432 GACCTCAGGATGGAAGCCTCGGG - Intronic
1183160654 22:36110781-36110803 GACCCCAGTTTTGCAGACTCCGG + Intergenic
1184259707 22:43307602-43307624 GACCTCAGTTTGGAACCCCCTGG - Intronic
1184375933 22:44112546-44112568 GACCCTGTTTTGGGAGCCTCAGG - Intronic
1184425047 22:44404285-44404307 GACCACTGTTTGGCAGCCACTGG - Intergenic
952890467 3:38037015-38037037 GTCCTCATCTCAGCAGCCTCTGG - Intergenic
953781071 3:45871300-45871322 GAACCCATTTTTGCACCCTCAGG + Intronic
954104768 3:48404057-48404079 GACCTCAGTTGAGCTGCCTCTGG - Exonic
954604390 3:51897510-51897532 CACCCCCTTGTGGCAGCCTCAGG + Intronic
954664874 3:52246282-52246304 GGCCTCATCTTGGAAGCCCCTGG - Exonic
960504130 3:118472298-118472320 GACCTGATTAGGGCAGCCTTAGG + Intergenic
960691381 3:120349510-120349532 GATGACAATTTGGCAGCCTCTGG - Intergenic
962009980 3:131382874-131382896 GACCACATTTTGACAACCACTGG + Exonic
962960106 3:140303258-140303280 GACCACATCTTGGCCTCCTCTGG - Intronic
963356395 3:144213425-144213447 AACCTCTTTTTCCCAGCCTCAGG - Intergenic
964043296 3:152291065-152291087 GACATCATCTTGTTAGCCTCAGG - Intronic
966517022 3:180829746-180829768 GACGTCATCCTGGCAGCCTCAGG - Intronic
969456318 4:7301710-7301732 CACCTCATTTTGGTAGTTTCAGG - Intronic
972786743 4:42333295-42333317 GACTTCATTATGGCAGCATCAGG + Intergenic
978734074 4:112065374-112065396 GACCTCAGGTTACCAGCCTCTGG - Intergenic
979410056 4:120366603-120366625 GTCCACATGTAGGCAGCCTCAGG - Intergenic
983677347 4:170311217-170311239 GATCACTTTTTGGCAGACTCAGG + Intergenic
983997020 4:174194729-174194751 GAACTCCCTTTGGCAGGCTCTGG - Intergenic
985539926 5:483116-483138 GACCTGATGGTGGCGGCCTCGGG - Intronic
989658706 5:43774849-43774871 CCCCTCATTTTGTCTGCCTCTGG - Intergenic
991658255 5:68924658-68924680 GACCATATTGTTGCAGCCTCAGG - Intergenic
992448917 5:76858097-76858119 AACCTCATTTTGATAGCCTCAGG - Intronic
995887374 5:116911239-116911261 GACATCATCTTGACAGCCTAAGG - Intergenic
998552919 5:143094412-143094434 CACCCCCTTGTGGCAGCCTCAGG - Intronic
1002328955 5:178428637-178428659 GACCTCATTATGTCAGCGCCCGG + Intronic
1002654908 5:180738388-180738410 GAACTCATTCTGTCTGCCTCTGG + Intergenic
1010393291 6:75361023-75361045 GACTTCATTTTGGCAGTATCAGG + Intronic
1010896979 6:81376898-81376920 GACCTTATTTTGGTCCCCTCAGG + Intergenic
1012382875 6:98641073-98641095 AACCTCATTTTGTCTGCCACTGG - Intergenic
1012601682 6:101106147-101106169 TACCTTATTCTAGCAGCCTCAGG - Intergenic
1017550378 6:155499623-155499645 GACCTTACATTGGCAGCCCCTGG + Intergenic
1019813525 7:3182661-3182683 CATCTCATTTTGGCACCCTCAGG - Intergenic
1021999415 7:26210936-26210958 GACCACATTTTGAGAGCCACTGG + Intronic
1022414958 7:30169743-30169765 TGCCTCATGCTGGCAGCCTCAGG - Intergenic
1024189628 7:46993032-46993054 GACATCATTGTGGCATCCACTGG - Intergenic
1035116857 7:156532178-156532200 TACTTCATTGTGGCAGCCTGAGG - Intergenic
1035968764 8:4224324-4224346 GAGCACATTTTGGCAGCCTTAGG + Intronic
1036789071 8:11705580-11705602 TCCCCGATTTTGGCAGCCTCGGG + Intronic
1037680135 8:21090230-21090252 GACCTGCCTTTGACAGCCTCAGG + Intergenic
1038557220 8:28531596-28531618 GTCCCCATTTTGGCACTCTCAGG + Intronic
1041740878 8:61155364-61155386 GCCATCCTTTTGGCAGACTCAGG - Intronic
1044807687 8:96024708-96024730 GGCCTCCTGTAGGCAGCCTCAGG + Intergenic
1045059365 8:98398674-98398696 GTCCAATTTTTGGCAGCCTCGGG - Intergenic
1048227520 8:132603036-132603058 GTCCCCTTTTTGGCAGGCTCTGG + Intronic
1055478697 9:76688768-76688790 GACTTCCTTGTTGCAGCCTCAGG + Intronic
1062387198 9:136317483-136317505 GACCTCACCCTGGCAGCCCCAGG + Intergenic
1188587067 X:31790344-31790366 CACCTAATTTTGGTAGCCACAGG - Intronic
1199278220 X:145970944-145970966 CGCCTCCTTATGGCAGCCTCAGG + Intergenic
1201143039 Y:11044404-11044426 GGCCTCCTGTTGGCAGTCTCAGG - Intergenic
1201470927 Y:14334240-14334262 GACCTCAGACTTGCAGCCTCCGG + Intergenic