ID: 930026423

View in Genome Browser
Species Human (GRCh38)
Location 2:47031899-47031921
Sequence GCTGATGGGGAGCCACGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930026423_930026428 -2 Left 930026423 2:47031899-47031921 CCCACTCGTGGCTCCCCATCAGC 0: 1
1: 0
2: 0
3: 6
4: 120
Right 930026428 2:47031920-47031942 GCTTCCTTGACTCTCACCCCAGG 0: 1
1: 0
2: 3
3: 18
4: 209
930026423_930026430 0 Left 930026423 2:47031899-47031921 CCCACTCGTGGCTCCCCATCAGC 0: 1
1: 0
2: 0
3: 6
4: 120
Right 930026430 2:47031922-47031944 TTCCTTGACTCTCACCCCAGGGG 0: 1
1: 0
2: 0
3: 21
4: 189
930026423_930026429 -1 Left 930026423 2:47031899-47031921 CCCACTCGTGGCTCCCCATCAGC 0: 1
1: 0
2: 0
3: 6
4: 120
Right 930026429 2:47031921-47031943 CTTCCTTGACTCTCACCCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 265
930026423_930026436 25 Left 930026423 2:47031899-47031921 CCCACTCGTGGCTCCCCATCAGC 0: 1
1: 0
2: 0
3: 6
4: 120
Right 930026436 2:47031947-47031969 CCTCCTGCGTTCATCTTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930026423 Original CRISPR GCTGATGGGGAGCCACGAGT GGG (reversed) Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
900940902 1:5798092-5798114 GCTGATGGGGAGAGAGGAGGTGG + Intergenic
902038283 1:13473462-13473484 GCTGAAGGGGAGAAAAGAGTGGG + Intergenic
902260880 1:15223910-15223932 GGGGAAGGGGAGCCACGAGCAGG + Intergenic
902925592 1:19693876-19693898 GCTGTTGGGGAGCCCTGGGTGGG + Intronic
905091759 1:35435935-35435957 GCTGAGGGGGTGCCACCTGTTGG - Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
914858898 1:151370827-151370849 GCAAGTGGGGAGCCAGGAGTAGG + Intronic
922800272 1:228361903-228361925 GCTGAGGGGGAGCTGCCAGTGGG + Intronic
924118476 1:240771619-240771641 GCTGACGGGAAGCCTCGAGGAGG + Intergenic
1066662252 10:37748095-37748117 GCTGAGGGTGAGGCACGACTAGG - Intergenic
1071275234 10:84048296-84048318 ACTGAAGGGGAGGCAAGAGTGGG - Intergenic
1074903414 10:117839302-117839324 ACCGATGGGGAGCCAGGAGGGGG - Intergenic
1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG + Intergenic
1077305376 11:1866588-1866610 GCTTATGGGGGGCCAGGGGTAGG - Exonic
1077405210 11:2379513-2379535 GCTGAAGGGGAGTCACGGGAGGG + Intronic
1081688096 11:45056605-45056627 GAGGATGGGGAGCCAGGAGGAGG - Intergenic
1081716110 11:45251762-45251784 GCTGTTGGGGGGCCACAAGTGGG - Intronic
1081842667 11:46214599-46214621 GCTGATGGGAAGCTCTGAGTGGG + Intergenic
1083750812 11:64759631-64759653 GCTGCTGGGGAGCCTGGGGTGGG - Intronic
1089114913 11:116086917-116086939 GCAGATAGGGATCCCCGAGTGGG - Intergenic
1093581562 12:20790021-20790043 GCTGTTTGGGAGCCAGGAATTGG + Intergenic
1097446486 12:59678636-59678658 GCTCATGGGCAGCCACGGGTAGG + Intronic
1103942543 12:124508884-124508906 GCTGATGGGGGGACAGGAGGTGG + Intronic
1106144870 13:27041347-27041369 TCTGAGGGGAAGCCCCGAGTTGG - Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1111928971 13:94494132-94494154 GATCCTGGGGAGCCATGAGTGGG - Intergenic
1114791337 14:25661819-25661841 ACTGATGTGGAGACAAGAGTTGG - Intergenic
1118001310 14:61526257-61526279 GCTGATTTGGAGCCAGGACTGGG + Intronic
1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG + Intergenic
1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG + Intergenic
1131506584 15:93025181-93025203 GCTGATGGGGAGTGGCGAGTTGG + Exonic
1133920454 16:10148059-10148081 GCTGACAGGGAGCAACCAGTAGG - Intronic
1136163259 16:28435363-28435385 GTGGATGGAGAGGCACGAGTGGG + Intergenic
1136199707 16:28679624-28679646 GTGGATGGAGAGGCACGAGTGGG - Intergenic
1136216054 16:28793797-28793819 GTGGATGGAGAGGCACGAGTGGG - Intergenic
1138196461 16:55055723-55055745 TCTGAGGAGGAGCCACTAGTTGG - Intergenic
1138628826 16:58277013-58277035 CCTGATGGGGTGACAGGAGTGGG + Intronic
1138706936 16:58924792-58924814 GCTGTTGGGGAGGCAGAAGTGGG - Intergenic
1139472767 16:67187110-67187132 AATGATGGGGAGCCTGGAGTTGG - Exonic
1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG + Exonic
1142080031 16:88144053-88144075 CCTGCTGGGGAGACAGGAGTGGG + Intergenic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG + Intronic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1145988903 17:29066289-29066311 TCTGCTGGGGAGCAAGGAGTAGG + Intergenic
1146482561 17:33216735-33216757 GGTGATGGGGAGCCCCAAGAGGG + Intronic
1149576293 17:57715838-57715860 GGTGATGGGCAGCCTCGGGTGGG + Intergenic
1150999026 17:70352141-70352163 GCGGATGGGGAGCCAGAAGGGGG - Intergenic
1151799597 17:76370228-76370250 GCTGGTGGAAAGACACGAGTCGG + Intronic
1152638500 17:81439880-81439902 GCTGAGGGGCAGCCAAGAGAGGG - Intronic
1153797705 18:8640223-8640245 GCTGATGGAGAGCTAGAAGTTGG + Intergenic
1162492434 19:11001355-11001377 GCTGATTGGGAGCCAGAGGTAGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163820267 19:19492432-19492454 CCTCATGGTGAGCCACGTGTTGG + Exonic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
926092310 2:10058867-10058889 GCTGATGGCGAGCATCGAGCGGG - Exonic
926119629 2:10235041-10235063 GCTGATGGGGAGCAGCCAGAAGG - Intergenic
926135128 2:10331058-10331080 GCAGATGGGAGGCCACGAGATGG - Intronic
927168992 2:20352375-20352397 GGTGATGGGGAGCAATGAGATGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930385533 2:50689813-50689835 GCTGATGGGAAGCCTCAAATGGG - Intronic
933862879 2:86487644-86487666 GGTGATGGGGAGTTAAGAGTGGG - Intronic
936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG + Intergenic
941233244 2:162938287-162938309 GTGGATGGGGAGCCAGAAGTGGG - Intergenic
942362545 2:175187597-175187619 GGTGATGGGGAGACACTAGGAGG - Intergenic
943010206 2:182438799-182438821 GGCAATGGGGAGCCACTAGTGGG + Intronic
945184090 2:207122225-207122247 TCTGATGGGAAACCATGAGTGGG + Intronic
945929395 2:215840016-215840038 GCTGATGGGCAGCCACAACTTGG - Intergenic
946482482 2:220070410-220070432 GCTGAAGGGGAGCAAGGGGTTGG - Intergenic
948554281 2:238796517-238796539 GCTGATGTGGAGCAGGGAGTGGG - Intergenic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1171394681 20:24824311-24824333 GCTGATGGGGAGCCACTGTGTGG + Intergenic
1172624639 20:36340216-36340238 GCTGTTGGGCAGCCAGGAGAAGG - Intronic
1173701607 20:45076715-45076737 TCAGATGGGGAGCCATGACTGGG + Exonic
1175914552 20:62419596-62419618 GCTGAAGGAGATCCACGAGAAGG - Exonic
1179104123 21:38383436-38383458 GCTGGTGGGGAGCCTAGTGTTGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181824988 22:25507753-25507775 GCTGAAGGTGAGCCAGGAGGAGG + Intergenic
1182273793 22:29172030-29172052 GGCAATGGGGAGCCACGAGGAGG + Intergenic
1183308352 22:37096011-37096033 GCTGATGCTGAGCCCCGAGGTGG - Exonic
1184473588 22:44709177-44709199 GGTGGTGGGGAGCCACAAGCAGG - Intronic
1184512704 22:44942718-44942740 GCTGTCGGGGAGCCACGTGGAGG + Intronic
1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG + Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
952103584 3:30043419-30043441 GCTGCTGGGGAGACACAATTAGG + Intergenic
953552168 3:43911839-43911861 GCTGATGGGGAACCAGGCTTTGG - Intergenic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
970934611 4:21554365-21554387 TTTGATGGGGAGCCAAGACTGGG + Intronic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG + Intergenic
991583197 5:68177796-68177818 GCTGATGGGGAAGAATGAGTAGG + Intergenic
1001191201 5:169633157-169633179 TCTGATGGGAGGCCAAGAGTAGG - Intergenic
1001586560 5:172836751-172836773 GCTTATGGGGTCCCAGGAGTGGG + Intronic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG + Intronic
1016782296 6:147972765-147972787 GCTTGTGGCGAGCCACGTGTGGG + Intergenic
1020151470 7:5685037-5685059 GCTGATGGTGAGCCACGCTCTGG + Intronic
1023989469 7:45119485-45119507 GCTGAGGGGGCGCCACAAGGAGG - Intergenic
1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG + Intronic
1029611600 7:101629563-101629585 GATGATGGGGAGCCAGAAGGGGG + Intergenic
1031011051 7:116525730-116525752 GCTGAAGGGCAGCTACGTGTTGG - Intronic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1035574568 8:696505-696527 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574579 8:696550-696572 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574646 8:696853-696875 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574657 8:696898-696920 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1037608516 8:20457392-20457414 GCTTTTGGGCAGCCAGGAGTTGG - Intergenic
1038149336 8:24928312-24928334 GTCCATGGGCAGCCACGAGTGGG - Intergenic
1038428356 8:27479916-27479938 GCTGAAGGGAAGGAACGAGTGGG - Intergenic
1041630700 8:60083520-60083542 GATGATTGGGATCCAAGAGTGGG - Intergenic
1042560500 8:70069936-70069958 GCTGGTGGGGAGGCGCGGGTCGG - Intronic
1044765728 8:95572225-95572247 GCTGATAGTGATACACGAGTGGG + Intergenic
1048282214 8:133113999-133114021 CCTGATGGGCAGCCAAGACTGGG - Intronic
1049347274 8:142145713-142145735 AGTGATGGGGAGCCACCAGCAGG + Intergenic
1049824003 8:144655250-144655272 GCTGATGGGTGGCCATGGGTGGG - Intergenic
1050153687 9:2643316-2643338 GCTGATGGGGATGCAGGAGGAGG - Exonic
1061517308 9:131097138-131097160 GCTTGCGGGGAGCCACGAGCCGG - Intronic
1189239524 X:39515017-39515039 GGGGATGGGGAGCTGCGAGTGGG - Intergenic
1190337100 X:49269367-49269389 GCCAATGGAGAGCCACGCGTGGG - Intergenic
1192180888 X:68914848-68914870 GCTGCTGAGGAGCTGCGAGTGGG + Intergenic
1192510367 X:71717581-71717603 GCTGCTGGGGATCCACGCGGAGG + Exonic
1192516330 X:71763972-71763994 GCTGCTGGGGATCCACGCGGAGG - Exonic
1202113890 Y:21451739-21451761 GATTATGGGGAGCCCCGCGTTGG + Intergenic