ID: 930026429

View in Genome Browser
Species Human (GRCh38)
Location 2:47031921-47031943
Sequence CTTCCTTGACTCTCACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930026423_930026429 -1 Left 930026423 2:47031899-47031921 CCCACTCGTGGCTCCCCATCAGC 0: 1
1: 0
2: 0
3: 6
4: 120
Right 930026429 2:47031921-47031943 CTTCCTTGACTCTCACCCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 265
930026421_930026429 12 Left 930026421 2:47031886-47031908 CCAGCGTGGGGGACCCACTCGTG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 930026429 2:47031921-47031943 CTTCCTTGACTCTCACCCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 265
930026420_930026429 13 Left 930026420 2:47031885-47031907 CCCAGCGTGGGGGACCCACTCGT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 930026429 2:47031921-47031943 CTTCCTTGACTCTCACCCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 265
930026424_930026429 -2 Left 930026424 2:47031900-47031922 CCACTCGTGGCTCCCCATCAGCT 0: 1
1: 0
2: 0
3: 9
4: 178
Right 930026429 2:47031921-47031943 CTTCCTTGACTCTCACCCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930026429 Original CRISPR CTTCCTTGACTCTCACCCCA GGG Intronic
900379857 1:2378383-2378405 CTTCCTGGACTGTGACCCCTGGG + Intronic
900880445 1:5377666-5377688 CTTCTCTTACCCTCACCCCAAGG + Intergenic
901138475 1:7012696-7012718 CTTCCTTTCCTCTCACCACTGGG + Intronic
901161353 1:7178558-7178580 CTGCCTTGACTCTTAGCCAAGGG + Intronic
903295910 1:22342960-22342982 CCTCCTGGACTCCCACTCCAGGG + Intergenic
903333931 1:22612621-22612643 CTTCCTTAAAACTCAACCCAAGG - Intergenic
903334424 1:22615448-22615470 TTTCTTTGACACTCACCACAGGG + Intergenic
904377212 1:30089343-30089365 CCTCCTTGACTCAGGCCCCAAGG - Intergenic
905018835 1:34794804-34794826 CTGCTTTGTCTCTCGCCCCACGG + Exonic
905854002 1:41295281-41295303 GTTCCCTGACTCTCACCCTCGGG - Intergenic
908580698 1:65513019-65513041 CCTCCTTGACTCTTACAGCATGG + Intronic
911122597 1:94311049-94311071 CTTCCTTGCCTCTCTCCTCTTGG + Intergenic
912911762 1:113767960-113767982 CCTCTTTTACTCTCACCCCCAGG - Intronic
914897538 1:151690319-151690341 CTGACTTGAAGCTCACCCCAGGG + Intronic
915108800 1:153550017-153550039 CTGCCCTGACACTCAACCCAGGG + Intronic
915509362 1:156378134-156378156 CTCCCCAGACTCTCACCCCCAGG - Exonic
915874219 1:159595210-159595232 CTTCCTTATCTCTCTCACCAGGG + Intergenic
915882723 1:159689213-159689235 CTTCCTTGGCTCTTGCCTCAGGG - Intergenic
917201644 1:172523173-172523195 CTTCGTTCACTATCACCCCAGGG + Intergenic
917930242 1:179817818-179817840 CTTCCTTCACCCTCGGCCCAGGG + Intergenic
919805747 1:201380143-201380165 CTTCCTAGGCTCTTACTCCACGG + Intronic
919916181 1:202140845-202140867 CTTGTTTGTCTCTCATCCCAGGG + Intronic
920294261 1:204946341-204946363 CTTCCTTGTCTCTAACCCGCAGG - Intronic
921731506 1:218584852-218584874 CTACGTTGGCTCCCACCCCAGGG + Intergenic
922768512 1:228168962-228168984 CCTCCTTGAGTGTCTCCCCAGGG + Intronic
1063599344 10:7465766-7465788 CCTCCTTGGCTCTCACCCTCTGG + Intergenic
1064093561 10:12406206-12406228 CTTCCCTGACTCCTACCCCGTGG + Intronic
1065122452 10:22542927-22542949 CTTCCTGGACCCTGAGCCCAAGG - Intronic
1066495342 10:35937008-35937030 ACTCCTTGAATCTCTCCCCAGGG - Intergenic
1067767350 10:49097067-49097089 CTTCCTGGGCCTTCACCCCAGGG - Intronic
1070248450 10:74753176-74753198 CTTCCTTCATTCACACCCCCCGG + Intergenic
1070681034 10:78449139-78449161 CTTCCTGGACTCTCACTTCCTGG - Intergenic
1072085805 10:92077948-92077970 CTCAGATGACTCTCACCCCAGGG + Intronic
1073270888 10:102262935-102262957 CTCCCTTCCCTCTCACTCCAGGG - Intronic
1073405005 10:103289895-103289917 CTTCCCTAACACTTACCCCATGG + Exonic
1076323511 10:129601733-129601755 CTTCCCTGACGGTCTCCCCAAGG - Intronic
1076804710 10:132849662-132849684 CCTTCTTCACTCTCAGCCCAGGG - Intronic
1077490368 11:2858259-2858281 CTTCATTGTCTCCCACCCCCCGG + Intergenic
1078005180 11:7527170-7527192 CTTCCTTGCCTCCCCTCCCAGGG - Intronic
1078558604 11:12351650-12351672 CCTTCCTCACTCTCACCCCAGGG - Intronic
1079747427 11:24150780-24150802 CTTCCTTCTCTTTCAGCCCAGGG + Intergenic
1084177170 11:67428949-67428971 CTTCCTTGGCTCTTACCCCTCGG + Intronic
1085573937 11:77585861-77585883 CTTCCTTGACTTTCATCACCTGG - Intronic
1086721187 11:90123433-90123455 CCTCCTAGACTCTCACTCAAAGG + Intergenic
1086948806 11:92870263-92870285 CTTCCCTGACTTTCACGCCAAGG - Intronic
1089376501 11:117998912-117998934 CCTCCCTGACCCTCACCCCCAGG + Exonic
1090243738 11:125201479-125201501 CAGCCTTGACTCTCTCTCCAGGG - Intronic
1091362296 11:134987200-134987222 CTCCCGTGAATCTCAGCCCAGGG + Intergenic
1091388916 12:113258-113280 CTTACTTGATTCTCACCACAAGG + Intronic
1091517946 12:1204491-1204513 TTTCCTTCAGTCTCACCTCAAGG + Intronic
1094488490 12:30943659-30943681 CTTGCTTGATTCTCACACAAAGG + Intronic
1097785646 12:63755927-63755949 CTACCTTGATTCTGCCCCCAAGG + Intergenic
1097969277 12:65615158-65615180 CTTCCTCACCTCCCACCCCATGG - Intergenic
1099653328 12:85457014-85457036 ATTTCTGGACTCCCACCCCATGG - Intergenic
1101403529 12:104408746-104408768 CTTCCTTATCTCTAACCCCGAGG - Intergenic
1101633130 12:106514937-106514959 TTTACTTGACTCTCACCACATGG - Intronic
1106140498 13:27007091-27007113 CCTCCCTGCCCCTCACCCCATGG + Intergenic
1107372869 13:39771504-39771526 CTTCCTTGACTCTGACTCCAGGG - Intronic
1107402845 13:40086167-40086189 CTTGCTGGGCTCCCACCCCAGGG - Intergenic
1108003253 13:45923796-45923818 CTGCCCTGGCTGTCACCCCACGG - Intergenic
1108453198 13:50587781-50587803 CTTCTTTCACTCTCACCCCTTGG + Intronic
1108483070 13:50894962-50894984 CTTCCATGACTCTCACCCACTGG - Intergenic
1108911393 13:55556158-55556180 CATCAGTGACTCTCACCTCAAGG + Intergenic
1109570140 13:64177417-64177439 CTTTCGTGACTCTCCCCTCAAGG - Intergenic
1110248597 13:73356265-73356287 CTTCCTTGACTCTCTGACAAAGG - Intergenic
1113326013 13:109282064-109282086 CTTCTCTGACTCTCGACCCAGGG - Intergenic
1114204675 14:20557624-20557646 CTTCCTTGACCCCTTCCCCAAGG - Intronic
1115693907 14:35876089-35876111 CCTTCTTGAGTCTCACCCCTTGG - Intronic
1117536743 14:56709784-56709806 CTTCCTTTATTCTCACTCCCAGG - Intronic
1117845357 14:59905953-59905975 CTTGCTTCTCTCTCACCACATGG + Intergenic
1117869412 14:60184302-60184324 ATTCATTAATTCTCACCCCAGGG + Intergenic
1118807242 14:69249009-69249031 CTTCAGTGATTCTCAACCCATGG - Intergenic
1119210576 14:72828655-72828677 CTTCATTGCTCCTCACCCCATGG - Intronic
1119909283 14:78335043-78335065 CATCCCAGGCTCTCACCCCAAGG + Intronic
1121110087 14:91306843-91306865 CTTCCGTGATTCTCACATCAGGG - Intronic
1121572198 14:94954738-94954760 CTTCCCTGCCTCTCTCCCTATGG - Intergenic
1121863301 14:97339369-97339391 CTGCCTTAACTCTCACTCCCAGG + Intergenic
1122043427 14:99006995-99007017 CCTCCTTGACTCTGAACTCAGGG - Intergenic
1202915502 14_GL000194v1_random:167545-167567 CTTCCTTGATTATCAACCCTTGG + Intergenic
1202877237 14_KI270722v1_random:15507-15529 CTTCCTTGATTATCAACCCTTGG - Intergenic
1126913877 15:53443781-53443803 CCCCCTAGACTCTCACCCCTGGG + Intergenic
1127648789 15:60986095-60986117 CTACCTTTACTCTCAATCCAGGG - Intronic
1129074756 15:72984044-72984066 CATACTTGACTCTCTCTCCAGGG + Intergenic
1131147781 15:90025279-90025301 CTTCCTTCACTCTCTGGCCAGGG + Intronic
1131431284 15:92391252-92391274 CTTCAGTGACTCTCATCGCAAGG + Intergenic
1132019640 15:98349208-98349230 CCTCCTTCACCCCCACCCCATGG + Intergenic
1133225965 16:4340531-4340553 CTTCCTTCAGTGGCACCCCAGGG + Intronic
1133346630 16:5075530-5075552 CTTCCTAGACTCTCACCACTTGG - Exonic
1135544685 16:23357761-23357783 CTTCCTTGAGGGCCACCCCATGG + Intronic
1136089375 16:27907427-27907449 CTTCCTTGACTGTCCCTGCAAGG + Intronic
1138122204 16:54409775-54409797 CTTCCTTGATTCTTCCTCCATGG - Intergenic
1138457884 16:57131786-57131808 CTTCATTCACTCCCACCTCAGGG + Intronic
1138621075 16:58211795-58211817 CTTTCTAGATTCTCTCCCCACGG + Intergenic
1138994464 16:62432464-62432486 CTTCCCTGACTCTCACTTCTAGG - Intergenic
1140250143 16:73288149-73288171 CTCTCTTGCCTGTCACCCCATGG + Intergenic
1140445330 16:75022849-75022871 CCTCCTAGACTCTCAGCACAAGG - Intronic
1141285395 16:82667275-82667297 CTTCCTTCACTCTCACTCTCTGG - Intronic
1141424284 16:83935354-83935376 CCTGATTGACTCTTACCCCAGGG - Intronic
1143338193 17:6189227-6189249 CTTCCTGGCCTGACACCCCAAGG + Intergenic
1143474528 17:7195200-7195222 CTTCCCTGGTTCTGACCCCAGGG - Intronic
1144223367 17:13120473-13120495 CTTCCTTCTCTCTTTCCCCAGGG + Intergenic
1144764078 17:17723594-17723616 CTCCCTTGGCTCTCACCGCGGGG - Intronic
1144944099 17:18961045-18961067 CTGACCTGCCTCTCACCCCAAGG + Intronic
1145979792 17:29004879-29004901 CTCCCTTGCCGCTCACACCATGG + Intronic
1146379566 17:32318859-32318881 CTTCCTTACTTCTTACCCCATGG + Intronic
1147244628 17:39111795-39111817 CATCCTTAGCCCTCACCCCAGGG - Intronic
1147571450 17:41573580-41573602 CTTCCTGTACTCTCGCCCCCTGG + Intergenic
1148220516 17:45858548-45858570 CGTCATTGCCTCTCAGCCCAGGG + Intergenic
1151583995 17:74997448-74997470 CTCCCTTGCCCATCACCCCACGG + Intronic
1152070237 17:78130697-78130719 CCTCCTCCCCTCTCACCCCATGG - Intronic
1157582210 18:48780240-48780262 CTGCCTTGGCTCACACCCCAGGG - Intronic
1158608740 18:58919529-58919551 CGTCCTTTCCTCTCCCCCCAGGG + Exonic
1161220721 19:3116883-3116905 CTGCCTTGAGACCCACCCCAGGG + Intronic
1161605051 19:5210218-5210240 CTTCCTTGAATATCATCCCCTGG + Intronic
1161902096 19:7126499-7126521 CATCCTTCACTCTCACTCAATGG + Intronic
1161988535 19:7670709-7670731 CTACCTTGACGCTCACCCTGGGG + Intergenic
1163521948 19:17796683-17796705 CCTCCCTCACTCTCACCCCTAGG + Intronic
1164224970 19:23236211-23236233 CTTTCTTGACTCCTACCACAGGG + Intronic
1164847380 19:31445225-31445247 CTTCCTTTTCTCTCAGCCCCAGG + Intergenic
1166186284 19:41141247-41141269 CTTCCTTGACTATGACACCCAGG + Intergenic
1168129132 19:54306241-54306263 CTCCCTGGACCCTCAACCCAGGG + Intergenic
1202673443 1_KI270710v1_random:17426-17448 CTTCCTTGATTATCAACCCTTGG + Intergenic
927494355 2:23542642-23542664 CTTCCTGCATTCTCTCCCCAGGG + Intronic
928635473 2:33241392-33241414 CTGCCTTGACTCTGATGCCATGG - Intronic
930026429 2:47031921-47031943 CTTCCTTGACTCTCACCCCAGGG + Intronic
930746235 2:54885954-54885976 CTTCCTTGCCTCTCATCGTAGGG + Intronic
930929475 2:56862730-56862752 CTTCCTTCTCTTTCAGCCCAGGG + Intergenic
932224107 2:70025527-70025549 CCTCCTTTCCTCCCACCCCATGG - Intergenic
934842557 2:97637379-97637401 CTTCCTGGCTTCTCATCCCAGGG + Intergenic
936257805 2:110932245-110932267 CTTTCTTTACTCCCACCCCAAGG - Intronic
936719046 2:115227574-115227596 TTTCCTTGACTCTCACTCTTTGG + Intronic
937232634 2:120407029-120407051 CCTCCCTGACCCACACCCCATGG - Intergenic
938669957 2:133577225-133577247 CTTCCTTCTCTCTCACCACAGGG - Intergenic
939446860 2:142321465-142321487 TTTCCTTGATTCTCCCCTCAGGG - Intergenic
939738115 2:145874962-145874984 CATCCTTGACTCTCTCAGCAAGG - Intergenic
941043318 2:160647387-160647409 CCTCCCTGACTCTAGCCCCAGGG - Intergenic
944398708 2:199300424-199300446 CTTCATTTACTCTCACCAGAAGG + Intronic
948280230 2:236741149-236741171 TTTCCTTGCCTCTCAACACATGG + Intergenic
948386644 2:237584898-237584920 TAACCTTGACTCTCTCCCCAGGG + Intronic
1169652477 20:7884925-7884947 CATCATTGTCTCTCATCCCATGG - Intronic
1169778650 20:9284366-9284388 CTCACTTGACTCTAACCACATGG - Intronic
1172592457 20:36127415-36127437 CTTACTCGTCTCTCACCTCAGGG - Intronic
1173893992 20:46536464-46536486 CTTCCATTACTCCCAACCCAAGG - Intergenic
1173936881 20:46874385-46874407 CCTTGTTGACTCTGACCCCATGG - Intergenic
1174125057 20:48298232-48298254 CTCCCTTGATTCTCACCCCATGG + Intergenic
1174507844 20:51028214-51028236 GTCCCCTGACTCTCAGCCCAGGG - Intergenic
1175207755 20:57324788-57324810 CTTCCATGACTGTCAACTCATGG - Intergenic
1176634854 21:9182193-9182215 CTTCCTTGATTATCAACCCTTGG + Intergenic
1176638512 21:9272951-9272973 CTTCCTTGATTATCAACCCTTGG - Intergenic
1178306312 21:31493647-31493669 CTTCGTTGCCTCTCAAACCAAGG - Intronic
1178994155 21:37382385-37382407 TTTCCTTTACACTCACTCCAGGG - Intronic
1180370458 22:12030464-12030486 CTTCCTTGATTATCAACCCTTGG + Intergenic
1180371816 22:12045786-12045808 CTTCCTTGATTATCAACCCTCGG - Intergenic
1180422554 22:12880448-12880470 CTTCCTTGATTATCAACCCTTGG - Intergenic
1180875789 22:19174743-19174765 CTTGCATGACTCTTCCCCCACGG + Intergenic
1180904632 22:19400810-19400832 CTTCCACTACTTTCACCCCACGG + Intronic
1181668088 22:24412177-24412199 CTTCCCTGACCCTGTCCCCAAGG - Intronic
1182301106 22:29337652-29337674 CTTCCTTGACACTGACAACATGG + Intronic
1182477720 22:30585211-30585233 CTTCCATGCCTCTCATCCCTTGG + Intronic
1183166278 22:36149334-36149356 CTGCCCTCACTCTCACACCAAGG + Intronic
1183172712 22:36199571-36199593 CTTCCCTCACTCTCACACCAAGG + Intronic
1183177307 22:36233418-36233440 CTTCCCTCACTCTCACACCAAGG + Exonic
1183563749 22:38597712-38597734 TTTCCTTTTCTCTCAGCCCAAGG + Intronic
1184339680 22:43879340-43879362 CCTCCTTCAGTCTCACCCCAGGG + Intergenic
1184449318 22:44573636-44573658 CTTCCTTGACCCTCCATCCAGGG + Intergenic
1184503935 22:44889918-44889940 ATACCTGGGCTCTCACCCCAGGG + Intronic
1184720494 22:46309693-46309715 CATCCTTGGCTCTCACCACAGGG - Intronic
949616765 3:5762187-5762209 GCTACTTGACTCCCACCCCAAGG + Intergenic
949907849 3:8873447-8873469 GTTCCTGGACCCTCAACCCAGGG + Intronic
950271656 3:11620762-11620784 CCTCCTTCCCTCTCACCCCCAGG + Intronic
950810685 3:15647267-15647289 CTTCCCTGCCTCAAACCCCAGGG + Intergenic
952083848 3:29794260-29794282 GTTCCTTAGCTCTCTCCCCAGGG + Intronic
952391186 3:32881899-32881921 CTTTTGTGACTCTCAGCCCAAGG + Intronic
952498943 3:33941153-33941175 CTTCCTCAACTCCCACCCCTGGG - Intergenic
952982446 3:38748595-38748617 CTTCATGGACTCTCCCACCAGGG - Intronic
953988078 3:47460979-47461001 GCTCCTGGACCCTCACCCCAAGG - Intronic
954568505 3:51620540-51620562 CTTCCAGGACTCTTTCCCCAGGG - Intronic
955076351 3:55617247-55617269 CTACCTTAACTCACACCACAGGG + Intronic
955345222 3:58156069-58156091 CTTCCTTGCATCTCACCTGAAGG - Exonic
955397127 3:58565591-58565613 CATCCCAGACTCCCACCCCAGGG - Exonic
955903630 3:63784007-63784029 TTTCCTTGACTCTCACTTAAAGG + Intergenic
957485405 3:80855330-80855352 CTTCCTTCACTCTGAAGCCATGG + Intergenic
961189324 3:124944506-124944528 CTTCCTTGCCATTCACCCTACGG - Intronic
961325294 3:126105924-126105946 CTTCCTGGACTTTCTCTCCAGGG - Exonic
961977357 3:131040964-131040986 CTTCCTTGAATCTCCCCTGAAGG - Intronic
962067271 3:131994973-131994995 CTTCCTTGACTCCTACCTCTAGG + Intronic
966041914 3:175501528-175501550 CTTCCCTGTCTCTCAGTCCAAGG - Intronic
966158160 3:176940487-176940509 TCTCCTTGTCTCCCACCCCATGG - Intergenic
966273476 3:178136919-178136941 ATTCCCTGGCTCTCATCCCAGGG + Intergenic
967882265 3:194310166-194310188 CTACTTGGACACTCACCCCAGGG - Intergenic
1202748383 3_GL000221v1_random:132070-132092 CTTCCTTGATTATCAACCCTTGG + Intergenic
968716992 4:2167540-2167562 GTTCTTTGACACTCACCTCAGGG - Intronic
971403270 4:26295877-26295899 CTTCCTCTAATTTCACCCCAGGG - Intronic
972061422 4:34878270-34878292 TCCCCTTGCCTCTCACCCCACGG - Intergenic
975890175 4:79018131-79018153 CTTCTTTCACTGTCATCCCATGG + Intergenic
979667488 4:123328283-123328305 CTTCTTTGACTCTCAGCCAATGG - Intergenic
981033346 4:140147874-140147896 CTTCTATGACACTCACACCAGGG + Intronic
981647941 4:147020914-147020936 CTTCAATGACTCTCCCACCATGG - Intergenic
982767668 4:159367009-159367031 CTTCCTTGGGTCTCACCCAGAGG + Intergenic
983785976 4:171729654-171729676 CTCCTTTGACTCTCACATCAAGG - Intergenic
984620418 4:181945779-181945801 TTTCCTTGACTCTTTCCCAAAGG + Intergenic
1202753400 4_GL000008v2_random:31365-31387 CTTCCTTGATTATCAACCCTTGG - Intergenic
985862107 5:2479134-2479156 CTGCCTTCACACTCACTCCAGGG + Intergenic
985948675 5:3206219-3206241 GTTCCTTGAGGCTCACCCTACGG + Intergenic
988514764 5:31894906-31894928 CTTGATGGAGTCTCACCCCATGG + Intronic
988694872 5:33611277-33611299 CTTCCTTCACTTTTTCCCCAGGG - Intronic
991417586 5:66408089-66408111 ATTCCTTCACTCTCATCCTAAGG + Intergenic
992503810 5:77366428-77366450 GTCTCTGGACTCTCACCCCATGG - Intronic
993843306 5:92907909-92907931 CTTTCTTGACTTTCACCATATGG - Intergenic
997697486 5:135873052-135873074 CTCCCTTGCCCCTCAGCCCATGG - Intronic
997826461 5:137111164-137111186 CCACCTTGACCCTCACACCATGG - Intronic
998398659 5:141836066-141836088 CTTCCTTGTCCCCCACCCAACGG + Intergenic
999258150 5:150221388-150221410 CTTCATTGCCTCTCTCCCCTTGG - Intronic
1001219092 5:169883775-169883797 CTTCCTTGAATCTCACCTGCTGG + Exonic
1001321086 5:170682177-170682199 ATTTCTTGACTCTTACTCCAGGG - Intronic
1001397837 5:171429445-171429467 CTTCCTGGACTCTGGCCCAAGGG - Intronic
1001592305 5:172873827-172873849 TTTCCTGGACTCCCACCCTATGG - Intronic
1002312028 5:178320655-178320677 CATCCTTGCCTCGCACCCCAGGG + Intronic
1002578611 5:180193472-180193494 CCTCCCTGACTTTCCCCCCAGGG - Intronic
1002923270 6:1588740-1588762 TTTCCTTCACTCTTACCACAAGG + Intergenic
1006074903 6:31525955-31525977 GTTCCTGGACTCTTACACCATGG + Intergenic
1006250128 6:32776501-32776523 CTTCCCTGTCTCTATCCCCAGGG - Intergenic
1006342193 6:33452889-33452911 CTTCCATGACTCTGTCCCCTGGG + Exonic
1007020808 6:38519153-38519175 CTTCCTTTACTCTGAGCTCAGGG + Intronic
1007449271 6:41930835-41930857 TTTCCTTGCCTCTGGCCCCAGGG + Intronic
1007589326 6:43011984-43012006 CTTCCATGTCTGTGACCCCAGGG - Exonic
1008657195 6:53627907-53627929 CTGCCTTGACTTCCACCCCCAGG - Intergenic
1010445736 6:75946494-75946516 CCTCCCTGACTTTTACCCCAGGG + Intronic
1013355073 6:109339398-109339420 GGTCCTTGAGTCTCTCCCCAGGG + Intergenic
1013587937 6:111596063-111596085 TTTCCTTGGCTGTCACCTCAGGG + Intronic
1013616012 6:111843886-111843908 CTTCCTTGACACTCCCCTAAAGG - Intronic
1015090796 6:129355598-129355620 CCTCCCTTACTCTCACCCCCAGG - Intronic
1015920120 6:138258097-138258119 CTTCATTGACTCTCCCATCAAGG + Intronic
1017898488 6:158701491-158701513 CCTCCATGACCCTCTCCCCATGG - Intronic
1017992151 6:159500159-159500181 CTCCCTTTTCTCTCTCCCCAGGG + Intergenic
1023852755 7:44159326-44159348 CTGCCCTGCCTCTGACCCCATGG - Intronic
1024258671 7:47558317-47558339 CTTCTTTTATTCTTACCCCAGGG + Intronic
1026962780 7:74419656-74419678 CATCTCTGACTCTCAGCCCAGGG + Intergenic
1026982723 7:74536146-74536168 CCTCCCTGACTCTCCCCACAGGG + Exonic
1030484844 7:110152300-110152322 CCTCCATGACTCTAACTCCAGGG + Intergenic
1032553348 7:132806080-132806102 CTTCCTTCCCTGTCACCCCCAGG - Intronic
1032649196 7:133858743-133858765 CTTCCTGTACTTTTACCCCATGG + Intronic
1032979504 7:137265507-137265529 CTTCGTTGTCTCTCACGACAGGG - Intronic
1034222120 7:149454919-149454941 CTTCGTAGTCTCTCACACCATGG + Intronic
1034630937 7:152530078-152530100 CTTCCATGACTCCCAACCAAAGG - Intergenic
1037678954 8:21077193-21077215 CTTCCATGAATTTCTCCCCAGGG + Intergenic
1039426812 8:37493136-37493158 CTCCCTGGACTCTCATCCCCAGG - Intergenic
1039799576 8:40942507-40942529 CTTCCTTGCCTCTATCCTCAGGG + Intergenic
1041005779 8:53495815-53495837 CTTCCTCCAGTCTCACCCCCAGG - Intergenic
1044550876 8:93511191-93511213 CTTTCTTGCCTCCCACCCCCAGG + Intergenic
1045384867 8:101662413-101662435 CTTCCATCTATCTCACCCCACGG - Intronic
1045754618 8:105528138-105528160 CTTCCTTGATTCTCCCACCTGGG - Intronic
1048517500 8:135124196-135124218 CTTGCTAGACTTTCACTCCATGG + Intergenic
1048831162 8:138478736-138478758 CTTCCTCAACACTCACCCAAGGG - Intronic
1049268424 8:141681681-141681703 CTGCCTTGACTGACAGCCCATGG - Intergenic
1049364451 8:142230234-142230256 ATCCCTTGCCTCTCACCCCCTGG - Intronic
1049426001 8:142538155-142538177 CCTCCTTGACTCTTGCCCCATGG + Intronic
1051369025 9:16342434-16342456 CTTGCTTCACTCTCCCTCCAGGG - Intergenic
1053056139 9:34994035-34994057 CTTTCCTGCCTCCCACCCCATGG - Intronic
1053466128 9:38309989-38310011 CATCCATGATTCTCACCACAGGG - Intergenic
1056974766 9:91242137-91242159 CTTCCTTGACTCACTCGCCCTGG - Intronic
1057493229 9:95539224-95539246 CTGCCTTTACTCTTACACCATGG + Intergenic
1058036579 9:100259392-100259414 CTTCTTTGGCTCACACTCCATGG + Intronic
1058813378 9:108662200-108662222 CTTCCTGGCCTCTGACCTCATGG - Intergenic
1059734988 9:117091717-117091739 TTGCCCTGACTCTCTCCCCAGGG - Intronic
1059956880 9:119525502-119525524 CTTCCTTGACTCTCACTTGCTGG + Intergenic
1060319384 9:122541769-122541791 CTTCTTTGAGTTTCACCACAGGG - Intergenic
1060395282 9:123312368-123312390 CTTCCTTCCTTCTCACCCAAGGG - Intergenic
1062130874 9:134892412-134892434 CAGCCTGGACTCTCAGCCCAAGG - Intergenic
1062174282 9:135152353-135152375 CTCCCTAGACTCCAACCCCAAGG - Intergenic
1203757633 Un_GL000218v1:149493-149515 CTTCCTTGATTATCAACCCTTGG + Intergenic
1203717022 Un_KI270742v1:162160-162182 CTTCCTTGATTATCAACCCTTGG + Intergenic
1203534191 Un_KI270743v1:16074-16096 CTTCCTTGATTATCAACCCTTGG - Intergenic
1203651249 Un_KI270751v1:125749-125771 CTTCCTTGATTATCAACCCTTGG + Intergenic
1186232467 X:7470769-7470791 CTGGTTTGACTCTCACTCCAAGG - Intergenic
1186288588 X:8072002-8072024 CTTCACTGTCTCTCACACCAAGG + Intergenic
1186818385 X:13260634-13260656 CTCCATTCACTGTCACCCCACGG + Intergenic
1186987781 X:15035764-15035786 CTTCCTTGTCTATAACCCCCAGG + Intergenic
1188274184 X:28179750-28179772 CTTCCATGATTCCTACCCCACGG + Intergenic
1191677460 X:63806707-63806729 CTTCCTGCACTCTCCCCCAAAGG + Intergenic
1191979521 X:66910629-66910651 CTTTCTTAACTCTCTCCCCCAGG + Intergenic
1192498641 X:71633805-71633827 CTGCCTTGTTTCTCTCCCCAGGG - Intergenic
1197801566 X:130354921-130354943 TTCCCTTGACTCTCTTCCCATGG - Intronic
1198575487 X:138006018-138006040 CTTCCCTGTCTCTCACAACATGG + Intergenic
1200863423 Y:8017114-8017136 CTTCCTGGACATTCACCACAAGG - Intergenic
1201171205 Y:11267096-11267118 CTTCCTTGATTATCAACCCTTGG + Intergenic