ID: 930026430

View in Genome Browser
Species Human (GRCh38)
Location 2:47031922-47031944
Sequence TTCCTTGACTCTCACCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930026424_930026430 -1 Left 930026424 2:47031900-47031922 CCACTCGTGGCTCCCCATCAGCT 0: 1
1: 0
2: 0
3: 9
4: 178
Right 930026430 2:47031922-47031944 TTCCTTGACTCTCACCCCAGGGG 0: 1
1: 0
2: 0
3: 21
4: 189
930026420_930026430 14 Left 930026420 2:47031885-47031907 CCCAGCGTGGGGGACCCACTCGT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 930026430 2:47031922-47031944 TTCCTTGACTCTCACCCCAGGGG 0: 1
1: 0
2: 0
3: 21
4: 189
930026421_930026430 13 Left 930026421 2:47031886-47031908 CCAGCGTGGGGGACCCACTCGTG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 930026430 2:47031922-47031944 TTCCTTGACTCTCACCCCAGGGG 0: 1
1: 0
2: 0
3: 21
4: 189
930026423_930026430 0 Left 930026423 2:47031899-47031921 CCCACTCGTGGCTCCCCATCAGC 0: 1
1: 0
2: 0
3: 6
4: 120
Right 930026430 2:47031922-47031944 TTCCTTGACTCTCACCCCAGGGG 0: 1
1: 0
2: 0
3: 21
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930026430 Original CRISPR TTCCTTGACTCTCACCCCAG GGG Intronic
900370107 1:2328473-2328495 TTCCTTGACTCTTGCCTCACTGG - Intronic
901138476 1:7012697-7012719 TTCCTTTCCTCTCACCACTGGGG + Intronic
901859350 1:12064113-12064135 TTCCTTGACCCTCCAGCCAGTGG - Intronic
902337932 1:15764651-15764673 TTCCTTGTCTCACACCCGCGAGG - Exonic
903124107 1:21236145-21236167 TTCCCTGACTCCCATCCCACTGG + Intronic
903295911 1:22342961-22342983 CTCCTGGACTCCCACTCCAGGGG + Intergenic
906147974 1:43571124-43571146 TTCCTTGCCTATCACTCCACTGG + Intronic
908574203 1:65441796-65441818 TTCTTAGGCTGTCACCCCAGAGG - Intronic
908953164 1:69587405-69587427 TTCCTTCAATCTCACCTCTGTGG + Intronic
912546605 1:110455814-110455836 TGCCCTGACTCACACCCTAGAGG - Intronic
914707654 1:150183964-150183986 TTCCTTTCCTCTCACTTCAGTGG - Intergenic
916520419 1:165558394-165558416 TTCCTTGCCTCTCACACAGGGGG - Intronic
917523107 1:175764232-175764254 TTCCTTGACTCCTAGTCCAGTGG + Intergenic
917607438 1:176647456-176647478 TTTCTTGAGTCACACCCCACAGG - Intronic
918864299 1:189874575-189874597 CTCCTTGTCTCTCACTCCTGAGG - Intergenic
919916182 1:202140846-202140868 TTGTTTGTCTCTCATCCCAGGGG + Intronic
920172392 1:204080205-204080227 TCCCTCCACTCTCCCCCCAGCGG + Intronic
920273218 1:204782818-204782840 TATCTTGTCTCTCATCCCAGGGG - Intergenic
922768513 1:228168963-228168985 CTCCTTGAGTGTCTCCCCAGGGG + Intronic
924796657 1:247297557-247297579 ATCCTTCCCTCCCACCCCAGGGG - Exonic
1062909339 10:1202521-1202543 TCCCTTGACTCTGAGACCAGAGG + Intronic
1063882999 10:10550345-10550367 TTCCTTCTCTGCCACCCCAGAGG - Intergenic
1064586079 10:16840611-16840633 TTCCCTGCCTCCCACCCCGGAGG + Intronic
1067109442 10:43389831-43389853 CCCCTTGACTCTCTTCCCAGAGG - Intronic
1067323778 10:45246924-45246946 TTCCTCATCTCCCACCCCAGAGG + Intergenic
1068294576 10:55053010-55053032 TTCCTTGTCTCTCACCAACGTGG - Intronic
1069074485 10:64024064-64024086 TCCCTTGACTCTCACCAGGGAGG + Intergenic
1071878362 10:89866903-89866925 CTCTTTGACTCCCACCCCCGAGG - Intergenic
1073270887 10:102262934-102262956 TCCCTTCCCTCTCACTCCAGGGG - Intronic
1073903900 10:108254549-108254571 TTCCTTTATTCCCACCCCAACGG - Intergenic
1074960973 10:118445622-118445644 TTCCATCACTCTCCACCCAGAGG + Intergenic
1077519346 11:3022603-3022625 TTTCCTGTCTCTCTCCCCAGAGG + Intronic
1078514717 11:12011752-12011774 TTCCTTGCCTCCCACCTCAGAGG - Intergenic
1078558603 11:12351649-12351671 CTTCCTCACTCTCACCCCAGGGG - Intronic
1078656484 11:13245417-13245439 TCCCTTGACTCTCTCTCCAGAGG - Intergenic
1079540328 11:21565301-21565323 TTCCCTGACTCTTTCCCCTGTGG + Intronic
1085475929 11:76788925-76788947 CTCCTGGCCTCTCACCCCACAGG - Intronic
1086281648 11:85196174-85196196 TTCCTTGACTTCCACTCCAGTGG + Intronic
1086948805 11:92870262-92870284 TTCCCTGACTTTCACGCCAAGGG - Intronic
1087273944 11:96141568-96141590 TACCTTGGCTCTCATCCCTGAGG - Intronic
1087380234 11:97396496-97396518 TTTCTGGATTGTCACCCCAGTGG + Intergenic
1087640946 11:100753184-100753206 TTCCTGGAACATCACCCCAGCGG - Intronic
1090395136 11:126413941-126413963 TTCCTTGGCTGTCTCCACAGGGG + Exonic
1092961165 12:13598085-13598107 TTCCTTGGCTGGCACCGCAGTGG + Intronic
1093025123 12:14238841-14238863 TGCCTGGAATCTTACCCCAGAGG - Intergenic
1093374375 12:18406752-18406774 TTCCTTCCCTCTCACCTGAGAGG - Intronic
1094016918 12:25874536-25874558 TCCCTGGACTCCCACCCCAGAGG - Intergenic
1096588027 12:52636347-52636369 TTGCCTGACTCTCTCCCCAGTGG - Intergenic
1097274373 12:57802257-57802279 TACCTGCACACTCACCCCAGCGG - Exonic
1099909402 12:88811315-88811337 TACCTTCAATCTCACCACAGAGG + Intergenic
1100620868 12:96271447-96271469 TTCCTAGACCCACTCCCCAGTGG + Intergenic
1108453199 13:50587782-50587804 TTCTTTCACTCTCACCCCTTGGG + Intronic
1109502181 13:63252318-63252340 TTTCTTGAATCTCCCCACAGAGG + Intergenic
1118358218 14:65033387-65033409 TTCCTTTGCTCTCCCCTCAGCGG - Intronic
1118912717 14:70075299-70075321 TTCCTTTTCTCTCTCACCAGAGG + Intronic
1120189214 14:81424699-81424721 TTCCTGGGCTCTCATCTCAGTGG + Intronic
1121110086 14:91306842-91306864 TTCCGTGATTCTCACATCAGGGG - Intronic
1123118100 14:105903792-105903814 ATCCCTGCCTCTCTCCCCAGTGG - Intergenic
1123403108 15:20005233-20005255 ATCCCTGTCTCTCTCCCCAGTGG - Intergenic
1123512447 15:21011887-21011909 ATCCCTGTCTCTCTCCCCAGTGG - Intergenic
1124995399 15:34718819-34718841 ATCCTGGACTCTTACCCCACAGG + Intergenic
1125476720 15:40052865-40052887 GTCCTTCCCTCTCGCCCCAGAGG + Intergenic
1126384753 15:48082781-48082803 ATCTTTGACTCTCACCCAATAGG - Intergenic
1126867237 15:52949783-52949805 TCCCTTGCCTTTCACCCCATTGG - Intergenic
1128736340 15:70056022-70056044 TTCCTTCTCTCCCAGCCCAGTGG + Intronic
1129563847 15:76599748-76599770 TCCCTTTACTCCCACCCAAGAGG - Intronic
1131147782 15:90025280-90025302 TTCCTTCACTCTCTGGCCAGGGG + Intronic
1132981119 16:2739113-2739135 GTCCTGGAATCTCAGCCCAGGGG + Intergenic
1138529972 16:57629660-57629682 TTCCAGGACTCTCACCCACGTGG - Intronic
1140633796 16:76887194-76887216 TTCCTTGCCTCTGACAGCAGTGG - Intergenic
1143304457 17:5934867-5934889 TTCCTTCACACTCACCTCACAGG - Intronic
1143474527 17:7195199-7195221 TTCCCTGGTTCTGACCCCAGGGG - Intronic
1143578962 17:7813022-7813044 TTCCTTGACTCTCCTTCCAGAGG - Intronic
1144586188 17:16489319-16489341 CTCATTGACTCCCACCCCAGAGG + Intronic
1144889898 17:18488704-18488726 TTCCCTGACTCTCTCCCCTGCGG + Intronic
1145142316 17:20455613-20455635 TTCCCTGACTCTCTCCCCTGCGG - Intronic
1145793594 17:27643288-27643310 TTCCCTGACTCTCTCCCCTGCGG + Intronic
1145808404 17:27750844-27750866 TTCCCTGACTCCCTCCCCTGTGG + Intergenic
1146542701 17:33711391-33711413 CTCCTTGACTCTCACCCAGGTGG - Intronic
1147244627 17:39111794-39111816 ATCCTTAGCCCTCACCCCAGGGG - Intronic
1147267663 17:39244584-39244606 TTTCTTCACTCTCACCCCAAAGG - Intergenic
1147928473 17:43960896-43960918 TTCCTTGTTTCTCATCCCGGTGG - Intronic
1148220517 17:45858549-45858571 GTCATTGCCTCTCAGCCCAGGGG + Intergenic
1148339988 17:46867650-46867672 TTCCTTCAAGGTCACCCCAGCGG + Intronic
1148856574 17:50582240-50582262 TTCCTTCAGACTCAGCCCAGAGG - Intronic
1149023650 17:51999272-51999294 TTCCCTAACTCTTAGCCCAGAGG - Intronic
1149765193 17:59270149-59270171 TTCCCTAACTCTGGCCCCAGTGG - Intronic
1149867532 17:60158996-60159018 TCCTTTCACTCACACCCCAGGGG - Intronic
1149998664 17:61418051-61418073 CTCCCTGACTCTCACCCCTTTGG + Intergenic
1156392140 18:36660431-36660453 TTCCTGCAGCCTCACCCCAGTGG - Intronic
1157056972 18:44241301-44241323 TTGGCTGACTCTCAGCCCAGTGG - Intergenic
1157690343 18:49676936-49676958 TCACCTCACTCTCACCCCAGGGG + Intergenic
1158615280 18:58981448-58981470 CTCCTTGCCTTTCACCCCACAGG + Exonic
1160238209 18:77102294-77102316 TTCCTTGACTCTCTCATAAGGGG + Intronic
1165283030 19:34814342-34814364 TCCCCTGACTATCACCCCACTGG + Intergenic
1166511175 19:43409913-43409935 TTCCTGTACTCCCACCCAAGAGG + Intronic
1167218528 19:48181948-48181970 TTCCTTCCCTCTGTCCCCAGAGG - Intronic
1168175925 19:54627764-54627786 TTCCTCTACTCTCACACCACAGG + Intronic
925496756 2:4459377-4459399 ACCCTTGACTCTCAGCCGAGAGG + Intergenic
926147100 2:10403212-10403234 TTCTTTGAGTCTATCCCCAGAGG - Intronic
926147664 2:10406493-10406515 TTCCTTCACCCACACCTCAGTGG - Intronic
927640037 2:24840453-24840475 TTCCTGGACTACCACCCCTGGGG + Intronic
928174670 2:29025668-29025690 CCCCTAGAGTCTCACCCCAGTGG - Intronic
928379502 2:30805393-30805415 TTCCCTGACTCTCACTCCCCTGG + Intronic
929961888 2:46503185-46503207 CTCCTGGACTCTCAGCCCATTGG - Intronic
930026430 2:47031922-47031944 TTCCTTGACTCTCACCCCAGGGG + Intronic
931306279 2:61031953-61031975 TTCCTTCACTCTCTGCCCAGAGG - Exonic
935724419 2:106010554-106010576 TTCCTGGGCTCCCACTCCAGAGG + Intergenic
936117468 2:109713458-109713480 TTCCTTGTCACTCAGCTCAGAGG - Intergenic
938669956 2:133577224-133577246 TTCCTTCTCTCTCACCACAGGGG - Intergenic
938949984 2:136246430-136246452 TTGCGTGACTCTCAGCACAGAGG - Intergenic
942512759 2:176719605-176719627 TTCCTTGACAGTCCACCCAGAGG + Intergenic
945286722 2:208089823-208089845 TTCCTTCACTCTCCTCCAAGTGG - Intergenic
947196897 2:227577135-227577157 TCCTTTGACTCTCTTCCCAGGGG + Intergenic
947681885 2:232041455-232041477 ATCCTTGACTCCTAGCCCAGTGG - Intronic
948984438 2:241511582-241511604 TTCCTTGTCTGTCAAACCAGAGG - Intergenic
1169730720 20:8782940-8782962 TTCCTTGACTCTAACTCAAAAGG - Intronic
1170331815 20:15220824-15220846 TTCCATGACTCTCACCAAACAGG - Intronic
1170713335 20:18811165-18811187 TACCTTGACTGCCACCCCATTGG - Intronic
1170786496 20:19472112-19472134 TTCCTAAACTCCCACCCCAGTGG - Intronic
1172070845 20:32255758-32255780 TTCCTTGACACTCCTCCCATTGG - Intergenic
1174125058 20:48298233-48298255 TCCCTTGATTCTCACCCCATGGG + Intergenic
1175938662 20:62526944-62526966 TTCCTGGAATCTGGCCCCAGTGG + Intergenic
1179353842 21:40640274-40640296 ATCCCTGACTTTCTCCCCAGCGG + Intronic
1180032045 21:45218613-45218635 TCCCTTGACTCTCAATTCAGGGG + Intronic
1181406984 22:22692116-22692138 TTCCCAGGCTCTTACCCCAGAGG - Intergenic
1181950597 22:26550861-26550883 TTCCCTTACTCACACCCCATTGG - Intronic
1182762105 22:32731026-32731048 CTCCATGACACTCACCCCAGAGG + Intronic
1182821794 22:33222878-33222900 TTCCTGGACTTTTTCCCCAGAGG + Intronic
1184132915 22:42528470-42528492 TTTCCTGACACTAACCCCAGAGG + Intergenic
952612080 3:35223846-35223868 TTTATTGACTCTCACATCAGAGG + Intergenic
952614549 3:35254230-35254252 TTCCTTTACTATCTACCCAGAGG + Intergenic
954568504 3:51620539-51620561 TTCCAGGACTCTTTCCCCAGGGG - Intronic
955076352 3:55617248-55617270 TACCTTAACTCACACCACAGGGG + Intronic
955578587 3:60394076-60394098 TACCCTGACCCTCACCCCTGAGG - Intronic
955684727 3:61538662-61538684 TTTCTTGGATCTCACCCAAGTGG - Intergenic
957184852 3:76928800-76928822 TTCATTGTCTCTCACCTCCGTGG + Intronic
960446197 3:117751784-117751806 TTCCTTAACACTCTCCCCATAGG - Intergenic
960949203 3:122988116-122988138 ATTCTCGAGTCTCACCCCAGAGG - Intronic
962365163 3:134774097-134774119 TTCCTTCTCTCTGGCCCCAGAGG - Intronic
965352581 3:167632388-167632410 TTTCTTGTCTCTTTCCCCAGTGG - Intronic
965548738 3:169942256-169942278 TTCTTTGTCTCTGACCCAAGAGG - Intergenic
968549518 4:1214891-1214913 GTCTTTGACTCCAACCCCAGCGG + Intronic
971403269 4:26295876-26295898 TTCCTCTAATTTCACCCCAGGGG - Intronic
974385982 4:61202102-61202124 TCCCTCTCCTCTCACCCCAGTGG + Intronic
976033786 4:80791348-80791370 CTCCTTGACTCTCAATCAAGAGG + Intronic
976213430 4:82693650-82693672 GGGCTTGCCTCTCACCCCAGGGG - Intronic
978440853 4:108731923-108731945 TTTGTTGCCTCTCACCCTAGTGG + Intergenic
979610809 4:122687054-122687076 TTCCTTCTCCCTCCCCCCAGAGG - Intergenic
979667487 4:123328282-123328304 TTCTTTGACTCTCAGCCAATGGG - Intergenic
983151470 4:164287343-164287365 TTCCTTGCCTGTCACTCCAAAGG + Intronic
985420999 4:189785259-189785281 TTCCTGGAGACTCAGCCCAGAGG - Intergenic
985862108 5:2479135-2479157 TGCCTTCACACTCACTCCAGGGG + Intergenic
985948676 5:3206220-3206242 TTCCTTGAGGCTCACCCTACGGG + Intergenic
987221287 5:15792845-15792867 TACCTTGATGCTCACACCAGTGG + Intronic
993040098 5:82804554-82804576 TTCCTTTTCTTTCACCCCTGAGG - Intergenic
993747044 5:91613189-91613211 TTCATTGAGTCACAGCCCAGTGG - Intergenic
995660539 5:114477978-114478000 GTCCTTGGCTCACAGCCCAGGGG + Intronic
998092737 5:139380630-139380652 ATCCCTGACTCTACCCCCAGAGG - Exonic
998504040 5:142657719-142657741 CTGCTGGACTCTCAGCCCAGTGG + Intronic
999093520 5:148958157-148958179 CTTCTTGACTCTCACCCCACTGG - Intronic
1000302134 5:159965745-159965767 TCCCTAGACTTTCACCACAGCGG - Intronic
1001592304 5:172873826-172873848 TTCCTGGACTCCCACCCTATGGG - Intronic
1002312029 5:178320656-178320678 ATCCTTGCCTCGCACCCCAGGGG + Intronic
1002578610 5:180193471-180193493 CTCCCTGACTTTCCCCCCAGGGG - Intronic
1002856410 6:1041737-1041759 TACCATGACTCTCATCCCTGTGG + Intergenic
1005049819 6:21674321-21674343 TCCCTGGGCTTTCACCCCAGCGG - Intergenic
1006143712 6:31945962-31945984 TTCCTTGACTGGCAGCTCAGCGG + Exonic
1006342194 6:33452890-33452912 TTCCATGACTCTGTCCCCTGGGG + Exonic
1006454845 6:34125780-34125802 TTCCCAGGCTCTCACCACAGTGG + Intronic
1007171683 6:39868623-39868645 TCCCTTGCCTCTCACCTCAGTGG - Intronic
1010600080 6:77814084-77814106 CTCATTGAATATCACCCCAGAGG + Intronic
1010877701 6:81128232-81128254 TTCCTTAACCCTCAACCCATAGG + Intergenic
1011118777 6:83926869-83926891 TACCTTGACTCTGATGCCAGAGG + Intronic
1013678553 6:112495214-112495236 TTCCTTCCCTCTCAACCCTGTGG - Intergenic
1014567828 6:122972478-122972500 TTACTTGTTTCTCTCCCCAGTGG + Intergenic
1015629060 6:135212989-135213011 TTCCTTGACTTTCACGACATAGG + Intronic
1017275778 6:152566213-152566235 TTCCTTCACTCTTATCTCAGTGG - Intronic
1017675369 6:156807721-156807743 TTCCTTGGATCACACCACAGTGG + Intronic
1018436027 6:163759738-163759760 TTCCTTGACTGTCAGCTCACAGG + Intergenic
1018869465 6:167770125-167770147 TGCCTGGACTCCCATCCCAGAGG + Intergenic
1026903689 7:74050752-74050774 TTTCTTGACTCCCACAACAGTGG - Intronic
1028348456 7:89813614-89813636 TTCCCTGACTCTTATCCCTGGGG - Intergenic
1029465941 7:100724668-100724690 TTCCATGTCCCCCACCCCAGGGG - Intergenic
1030460923 7:109835063-109835085 TTCACTGACTCTGACCCAAGTGG + Intergenic
1037246668 8:16843300-16843322 TACCTTGGCTCCCACCCCATTGG + Intergenic
1037272475 8:17145010-17145032 TTCAATGACACTCACACCAGTGG + Intergenic
1037810075 8:22081736-22081758 CTCCCTGCCCCTCACCCCAGAGG + Exonic
1038814387 8:30886440-30886462 TTCACTGACTCTAACCCTAGTGG + Intronic
1040871286 8:52102009-52102031 TTCCTGGACACCCATCCCAGTGG - Intergenic
1040939121 8:52814916-52814938 TTCCTTTACTGTCATTCCAGTGG - Intergenic
1041629979 8:60076326-60076348 TTCTTTGAGTTTCATCCCAGTGG + Intergenic
1041926301 8:63240849-63240871 TTCCTAAACTCTCAAGCCAGTGG - Intergenic
1042496052 8:69455715-69455737 TTCTTTGATTCTCACCTCTGCGG - Intergenic
1044621327 8:94193147-94193169 TCTCTCTACTCTCACCCCAGTGG - Intronic
1047144959 8:122188161-122188183 TTTATTGAATCTCATCCCAGTGG + Intergenic
1053007724 9:34615087-34615109 TCCCTTTGCTCTCAGCCCAGCGG + Intronic
1053511429 9:38691086-38691108 TTCCTGGGCTCTGCCCCCAGAGG - Intergenic
1057791390 9:98127339-98127361 TTCCTTCACCCCCACCCCAGTGG - Intronic
1059676283 9:116543653-116543675 TTCCTTGTCCCTCTCTCCAGTGG + Intronic
1061482704 9:130904828-130904850 AGCCTTGACCCTGACCCCAGAGG + Intronic
1061909322 9:133714432-133714454 TTCCTTGTCTCTCACCCAGATGG - Intronic
1187047814 X:15665260-15665282 TCACCTGACTCTCACCACAGCGG + Intergenic
1187477493 X:19625160-19625182 TTCCTTGCTTCCCACCCCACAGG - Intronic
1187510592 X:19914205-19914227 TTCCTTGACTCTCCTCCACGTGG + Exonic
1190233912 X:48601716-48601738 CTCCTTGAGTCTGACCACAGTGG - Intronic
1190797059 X:53755774-53755796 TTCCTGGACTTTCATCCCTGGGG + Intergenic
1192343779 X:70284568-70284590 TTCCTTGACACACACTTCAGCGG + Exonic
1197705167 X:129629772-129629794 TTCCTTGACTATCAATCAAGGGG + Intergenic
1197801565 X:130354920-130354942 TCCCTTGACTCTCTTCCCATGGG - Intronic
1201652168 Y:16301495-16301517 TTTCTTGACTCCCACCCTACTGG - Intergenic