ID: 930026787

View in Genome Browser
Species Human (GRCh38)
Location 2:47033970-47033992
Sequence CACGAAAGCCGGGTTTTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930026787_930026792 11 Left 930026787 2:47033970-47033992 CCGGAGAAAACCCGGCTTTCGTG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 930026792 2:47034004-47034026 TTGAAAAGCCTTCTGAATTCAGG 0: 1
1: 0
2: 0
3: 27
4: 250
930026787_930026793 12 Left 930026787 2:47033970-47033992 CCGGAGAAAACCCGGCTTTCGTG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 930026793 2:47034005-47034027 TGAAAAGCCTTCTGAATTCAGGG 0: 1
1: 0
2: 1
3: 28
4: 316
930026787_930026794 13 Left 930026787 2:47033970-47033992 CCGGAGAAAACCCGGCTTTCGTG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 930026794 2:47034006-47034028 GAAAAGCCTTCTGAATTCAGGGG 0: 1
1: 0
2: 3
3: 19
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930026787 Original CRISPR CACGAAAGCCGGGTTTTCTC CGG (reversed) Intronic
900284743 1:1893731-1893753 CAGGAGAGCCGGGTTTCCGCAGG + Intergenic
912492532 1:110070172-110070194 CACGGAAGCCGGGTTGGCGCTGG - Intronic
922108116 1:222530226-222530248 CACCAAAGCCAGGTTCTCTGTGG + Intronic
922343210 1:224674163-224674185 TAGGAAAGGCTGGTTTTCTCTGG - Intronic
1089993618 11:122883710-122883732 CACAAAAGCTGGGTTTTCTGTGG - Intronic
1104904467 12:132205881-132205903 CACGAAACCTGGGTGGTCTCAGG - Intronic
1121985413 14:98500867-98500889 CATGAAGTCCGGGATTTCTCTGG - Intergenic
1123931755 15:25175351-25175373 CAGGAAAGAAGGGTTTCCTCAGG + Intergenic
1128348102 15:66867503-66867525 CAGGAAAGATGGGTTTTCCCTGG + Intergenic
1128711975 15:69878839-69878861 CACCAAAGCCTGGTTTTCTGGGG + Intergenic
1130713783 15:86311573-86311595 ACCAAAACCCGGGTTTTCTCCGG + Intronic
1140454250 16:75095630-75095652 CCTGAGAGCCAGGTTTTCTCAGG - Intronic
1145067560 17:19772234-19772256 CACCAAAGCTGTGATTTCTCAGG + Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
928412825 2:31067511-31067533 CAGGAAAGCAGGGTCTGCTCAGG + Intronic
930026787 2:47033970-47033992 CACGAAAGCCGGGTTTTCTCCGG - Intronic
934054555 2:88240945-88240967 CACCAAACCTGGGTTTTCCCTGG + Intergenic
934955041 2:98609992-98610014 CAAGAAAGCAGGGTCATCTCTGG - Exonic
937381246 2:121379168-121379190 CAGGAAAGGTGGGTTTTATCTGG - Intronic
939803882 2:146748830-146748852 CCCTAAAGTCAGGTTTTCTCTGG - Intergenic
944491089 2:200258509-200258531 CATGAAAGTGGGGGTTTCTCAGG + Intergenic
947820036 2:233063133-233063155 CAGGGCAGCCGGGTTTTCTGCGG + Intronic
1168969837 20:1923494-1923516 CACCAATGCCAGGTTTTCTTAGG + Intronic
1171401950 20:24879455-24879477 CACGAAGGCTCAGTTTTCTCAGG - Intergenic
1172458442 20:35095906-35095928 CACCAAAGCTGGGTATTCACTGG + Intergenic
1174053585 20:47784096-47784118 CAGGAGAGACGGGCTTTCTCTGG - Intronic
950603150 3:14053690-14053712 CATGAAAGCCTGGATTTCTGTGG + Intronic
953887248 3:46722000-46722022 AACGCCAGCAGGGTTTTCTCAGG + Intronic
957574668 3:81991559-81991581 CAGTAAAGCAGGGTTTTATCAGG - Intergenic
958896316 3:99833666-99833688 TAAGAAAGCAGTGTTTTCTCAGG + Intronic
964762105 3:160144328-160144350 CACCAAAGCCAGGGCTTCTCTGG + Intergenic
967013253 3:185458791-185458813 AACAAATGCCGCGTTTTCTCAGG - Intronic
970342121 4:15118427-15118449 CACAAAAGCCACGTTTTCTTTGG - Intergenic
972892294 4:43573762-43573784 CATACAACCCGGGTTTTCTCAGG - Intergenic
991624535 5:68586347-68586369 CACTAAAGGCGGGATTTATCTGG - Intergenic
997446087 5:133941446-133941468 CATTTAAGGCGGGTTTTCTCTGG + Intergenic
1001717243 5:173826294-173826316 CACCAAAGCGGGTTTTTTTCTGG - Intergenic
1004787076 6:18981066-18981088 CACAAAAGCCTGGCTTTCTAAGG - Intergenic
1011454461 6:87532601-87532623 CTGGAAAGCCTGGTTTCCTCTGG + Intronic
1012533146 6:100263066-100263088 GATGAAAGCCTGATTTTCTCAGG - Intergenic
1020118355 7:5488799-5488821 GGCTAAAGCTGGGTTTTCTCAGG - Intronic
1034223238 7:149461039-149461061 CATGAACTCCGGGCTTTCTCTGG - Exonic
1040598958 8:48865632-48865654 CAGCAAAGCCGGGGCTTCTCTGG - Intergenic
1048814893 8:138323286-138323308 AAGCAAAGCCAGGTTTTCTCAGG + Intronic
1050061811 9:1717298-1717320 CACGAAAGCATGGTTTTCAAAGG - Intergenic
1050132498 9:2427294-2427316 CACAAAAGCCTTGGTTTCTCTGG + Intergenic
1052521294 9:29550848-29550870 CAGGAAAGCCTGTTTTTCTAGGG - Intergenic
1056316307 9:85393859-85393881 ATCAAAAGCAGGGTTTTCTCAGG + Intergenic
1060837396 9:126766807-126766829 CAAGAAAGATGGGTTTTCTTTGG - Intergenic
1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG + Intergenic