ID: 930028661

View in Genome Browser
Species Human (GRCh38)
Location 2:47045120-47045142
Sequence CTCACCAGTGGTGAGTAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930028661_930028669 10 Left 930028661 2:47045120-47045142 CCTCACTACTCACCACTGGTGAG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 930028669 2:47045153-47045175 TGCTGCCGTCTGGCCCTCGGTGG 0: 1
1: 0
2: 1
3: 9
4: 120
930028661_930028666 0 Left 930028661 2:47045120-47045142 CCTCACTACTCACCACTGGTGAG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 930028666 2:47045143-47045165 AACCGGGAGGTGCTGCCGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 76
930028661_930028673 27 Left 930028661 2:47045120-47045142 CCTCACTACTCACCACTGGTGAG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 930028673 2:47045170-47045192 CGGTGGTTCAAACTCTTCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 24
930028661_930028668 7 Left 930028661 2:47045120-47045142 CCTCACTACTCACCACTGGTGAG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 930028668 2:47045150-47045172 AGGTGCTGCCGTCTGGCCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930028661 Original CRISPR CTCACCAGTGGTGAGTAGTG AGG (reversed) Intronic
901167334 1:7229879-7229901 ATGACCATTGGTGAGAAGTGAGG + Intronic
901323014 1:8350696-8350718 CTCACCAGTGCTGATTTTTGAGG + Intergenic
903267243 1:22165158-22165180 CACACGAGTGGAGGGTAGTGAGG + Intergenic
904374248 1:30069839-30069861 CTCACCTCTGGTGAGTACAGGGG - Intergenic
904677663 1:32208193-32208215 CTGGCCATTGGTGACTAGTGGGG + Exonic
904989843 1:34583416-34583438 CTCCCAGGTGGTGATTAGTGAGG + Intergenic
906407224 1:45551525-45551547 CTCAGAAGTGGGGAGAAGTGGGG + Intronic
906554569 1:46698345-46698367 TTCACCAGTGGTGAATAATAGGG - Intronic
906966282 1:50459763-50459785 ATCAACAGTGTTGAGAAGTGGGG + Intronic
908834149 1:68211705-68211727 CTCATGAGTGGTGAGAAATGGGG - Intronic
910661905 1:89682401-89682423 CTCACCTGTTGTGAGTATTCAGG + Intronic
910772442 1:90843808-90843830 CTCAGCAGTGTGGAGTAGGGGGG - Intergenic
916893575 1:169137727-169137749 CTCAGAAGTGGTCAATAGTGAGG + Intronic
922420129 1:225454366-225454388 CTCACTAGTGGAGAGAGGTGAGG - Intergenic
1063491335 10:6466336-6466358 CACACTAGTGGTGAGCATTGGGG + Intronic
1063931511 10:11033167-11033189 CTGTCCAGTGGTGAGGTGTGAGG + Intronic
1064588935 10:16868670-16868692 CTCACCAGTGGTGTTTGATGTGG + Intronic
1068550263 10:58400201-58400223 CTCACCAATTCTGAGTAGTGAGG + Intergenic
1069868922 10:71521395-71521417 CTCAGCAATGGTGGGAAGTGTGG - Intronic
1070662249 10:78315465-78315487 TTCAGCTGTGGTGAGTAGAGTGG + Intergenic
1074402393 10:113152796-113152818 CTCAGCAGTGATCAGTGGTGTGG + Intronic
1077083846 11:737727-737749 CTCACGACTGGTGGGAAGTGTGG - Intergenic
1078264990 11:9748570-9748592 CTCACTGGTGGTGAGCACTGTGG + Intronic
1079622090 11:22567327-22567349 CTGCCCAGTGAAGAGTAGTGGGG + Intergenic
1081295338 11:41379719-41379741 ATCACCAGTGTTAAGTACTGAGG - Intronic
1083421018 11:62553358-62553380 CTCCCCAGTGGGGAGCAGGGAGG + Intronic
1086520282 11:87661244-87661266 CTGCTCAGAGGTGAGTAGTGGGG + Intergenic
1088729865 11:112671149-112671171 CTAACCAGTGAGGAGAAGTGAGG - Intergenic
1089400523 11:118161701-118161723 CTCACCAGTGGTTAGTAGTTAGG - Intergenic
1089529612 11:119118023-119118045 CTCATATTTGGTGAGTAGTGTGG - Exonic
1090192100 11:124779074-124779096 CTCACCGGTGCTGAATAGAGAGG - Intronic
1091214368 11:133891598-133891620 CTCTCCAGTGATGAGCAGGGTGG + Intergenic
1092170102 12:6369198-6369220 CTCCCCAGGGGAGAGGAGTGTGG - Intronic
1093011492 12:14111839-14111861 CTCAGCAGTGGGGAGGACTGAGG - Intergenic
1093191647 12:16081786-16081808 CTTGCCAGTGGTGATTTGTGTGG + Intergenic
1096463983 12:51838128-51838150 CTCACATGTAGTGAGAAGTGGGG - Intergenic
1102546860 12:113663560-113663582 CTAACGAGGGGTGAGTACTGGGG - Intergenic
1106285203 13:28312661-28312683 CTCAGCAGTGGAGACTGGTGGGG + Intronic
1112227988 13:97559213-97559235 CTCACCAGTGGTGAATTGAGAGG - Intergenic
1113758120 13:112828267-112828289 CCCAGCAGTGTTGAGTAGGGGGG + Intronic
1113758177 13:112828525-112828547 CCCAGCAGTGTTGAGTAGGGGGG + Intronic
1114360064 14:21961869-21961891 CTGGCCAGTGGGGAGAAGTGAGG - Intergenic
1114945901 14:27679913-27679935 CTTAAAAATGGTGAGTAGTGGGG + Intergenic
1116994565 14:51309080-51309102 CTGCCCAGAGGAGAGTAGTGAGG + Intergenic
1118313141 14:64707280-64707302 CTGGCCAGAGGTGAGTTGTGGGG - Intronic
1120719338 14:87873349-87873371 CTCACTAGTAATGAGTAGTGAGG - Intronic
1121568352 14:94927399-94927421 CACACCACTAGTGAGTGGTGGGG - Intergenic
1122473477 14:101988424-101988446 CACACCAGTGGAGAGTGTTGGGG + Intronic
1124174149 15:27406442-27406464 CTCACCAGTGATGAGCCATGTGG + Intronic
1131100069 15:89681185-89681207 CTCTGCAATGGTGAGTGGTGGGG - Intronic
1136378360 16:29878483-29878505 ATCACGAGTGGTGAGGACTGTGG - Intronic
1136539664 16:30922388-30922410 GTCACCAGTGGGGATCAGTGCGG - Intergenic
1142082968 16:88159801-88159823 GTCACCAGCGGTGGGCAGTGAGG + Intergenic
1145013733 17:19383914-19383936 CTCCCCTGTGGTGAGTACCGTGG - Exonic
1145108051 17:20136597-20136619 CCCACCAGTGGTGGGGAATGTGG + Intronic
1154191735 18:12236054-12236076 GTCATCAGTGGTGAGTGCTGTGG + Intergenic
1155683244 18:28515724-28515746 CACAGCAGAGGTGAGTAGTTAGG - Intergenic
1156446688 18:37242140-37242162 CTCAGCAGTGGAGAGAGGTGGGG + Intergenic
1158011802 18:52737275-52737297 ATCACCAGTGGTGTCTTGTGGGG - Intronic
1159084713 18:63775609-63775631 CTCAACAGTCTTGAGAAGTGTGG + Exonic
1159747269 18:72253899-72253921 CTGACCAGCTGTGAGGAGTGTGG + Intergenic
1159888067 18:73928225-73928247 CTCTACAGTGGTGAGTAGCAAGG + Intergenic
1160417545 18:78721511-78721533 CTCACCAGGGGTCCGTGGTGGGG + Intergenic
1161051663 19:2167147-2167169 CCCGCCAGTGGTGTTTAGTGCGG - Intronic
1163755515 19:19104315-19104337 CACACAAGTGGTGGGTGGTGAGG + Intronic
1163816342 19:19466881-19466903 CTCAGCAGGGGTGAGCAGTGAGG + Intronic
1166292348 19:41871260-41871282 CCCACCTGTGGTGGGTAGTTAGG + Intronic
1168314414 19:55478191-55478213 CTCAGCAGTGCTGAGATGTGGGG - Intronic
1168516975 19:57017047-57017069 CTCAGCCGTGGGGAGTTGTGAGG - Intergenic
1168568260 19:57442399-57442421 CTCACAAGTGGTGACCAGGGAGG - Intronic
925383800 2:3447784-3447806 CTCACCAGTGGAGAGCAGAGGGG - Intronic
925779463 2:7368946-7368968 CTCAACAGTAGTGAGTATTCTGG - Intergenic
930028661 2:47045120-47045142 CTCACCAGTGGTGAGTAGTGAGG - Intronic
933603965 2:84361407-84361429 CTGCCCAGTGATGAGAAGTGAGG - Intergenic
939117737 2:138079973-138079995 CTCCCCAGTTGTTGGTAGTGGGG - Intergenic
939461189 2:142497339-142497361 CTCACCAGTGGTGGATAGGGGGG + Intergenic
940649567 2:156428081-156428103 CCCAGCAGTGGGGAGAAGTGGGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947316114 2:228860806-228860828 CTCAATAGTAGTGAGTGGTGGGG + Intronic
947589302 2:231376273-231376295 CTGACCACTGGTGAGTCGGGCGG + Intergenic
948059023 2:235030194-235030216 CTCACCAGAGGTGGATGGTGAGG + Intronic
1168896091 20:1324700-1324722 CTCACCCGTGGGGAGCAGGGTGG - Intronic
1170388892 20:15850892-15850914 CTGACCAGTGGTAAGAAGTCAGG - Intronic
1171086916 20:22246093-22246115 CTCTCCACTGGAGAGCAGTGAGG + Intergenic
1175553701 20:59832977-59832999 CTCACCAGTGGAGGGGATTGAGG - Intronic
1176258618 20:64167069-64167091 CTCCCCAGTGCAGAGTGGTGTGG - Intronic
1177586365 21:23101490-23101512 CTCACCAGTGCTGAATAGAGAGG + Intergenic
1181019694 22:20092981-20093003 CTGAGCAGTGGTGACAAGTGGGG + Intronic
1181558669 22:23686893-23686915 CACATCAGTGGCGAGGAGTGCGG - Intergenic
1182383097 22:29910039-29910061 CTCCCGAGTAGCGAGTAGTGGGG - Intronic
1183438044 22:37806666-37806688 CCTCCCAGTGGTGAGCAGTGGGG + Exonic
1183489397 22:38108593-38108615 ATCAGCACTGGTGGGTAGTGGGG + Intronic
1184072903 22:42157107-42157129 CTCAAGAGTGCTGAGTGGTGGGG + Intergenic
1184800732 22:46757505-46757527 CTCAGCTGTGGTGTGAAGTGGGG + Intergenic
1184881261 22:47305741-47305763 CTCACCAGTGGTGTTTAGAGGGG - Intergenic
1185286397 22:50001743-50001765 CTCACCAGACGTGGGCAGTGTGG + Intronic
950115323 3:10447076-10447098 CTCACTAGTGCTGAGTCCTGGGG + Intronic
952808884 3:37383919-37383941 CACAACAGTGTTGGGTAGTGAGG + Intergenic
955913336 3:63880973-63880995 CACACAACTGGTGAGTAGTAGGG - Intronic
959476857 3:106822145-106822167 CCCACGACTGGTGAGCAGTGGGG - Intergenic
961205746 3:125080164-125080186 CTCAACACTGCTGAGGAGTGTGG + Intergenic
962254883 3:133863900-133863922 GGCACCACTGGTGAGTAGGGAGG - Intronic
965054295 3:163694843-163694865 ATCACCAGTGGTGGACAGTGAGG + Intergenic
967201629 3:187077136-187077158 CTCACCAGGTGTGAGAGGTGTGG + Exonic
968280625 3:197474143-197474165 ATGACCAGTGGTGAATGGTGTGG - Intergenic
969653044 4:8478870-8478892 CCCACCTGTGGTGAGCATTGTGG + Intronic
979828934 4:125276604-125276626 CTCCACAGTGGAGAGAAGTGTGG + Intergenic
981413721 4:144463383-144463405 CTGACCAGAGGAGAGAAGTGGGG + Intergenic
985112088 4:186556093-186556115 CTAACCAGTTGTGTGCAGTGAGG + Intergenic
985973173 5:3393304-3393326 CTCACCAGTGCGGTGCAGTGAGG + Intergenic
986276368 5:6278776-6278798 ATCTCCAGTGGTGAGTCCTGTGG + Intergenic
992974039 5:82093909-82093931 CTCACCAGTCGTAAGTCATGGGG - Intronic
993018557 5:82563942-82563964 CTGCCCAGTGGGGAGAAGTGAGG - Intergenic
994522154 5:100853549-100853571 TTCACCAGTGGTCAGAAGTTTGG + Intronic
995674170 5:114643704-114643726 CTGACCACTGGTGAGTGGGGTGG + Intergenic
996536402 5:124582275-124582297 CCCACCAGTGGGGGGTTGTGGGG - Intergenic
997698609 5:135880722-135880744 CAGAACAGTGGTGAGGAGTGAGG - Intronic
998253002 5:140564997-140565019 CTCAACAGTGTGGAGTGGTGTGG + Exonic
1001406612 5:171481499-171481521 CACACAGGTGGTGAATAGTGGGG + Intergenic
1001583535 5:172817071-172817093 ATCACAGCTGGTGAGTAGTGAGG - Intergenic
1002183012 5:177441237-177441259 CTTTCCAGAGGTGAGCAGTGTGG + Intronic
1002718198 5:181241988-181242010 CTCAGCATTGCTGAGGAGTGTGG - Intronic
1006345495 6:33478501-33478523 CTCCCCAGTTGGGAGTAGTTGGG + Intergenic
1018851668 6:167644890-167644912 CTCCCCTGGGGTGGGTAGTGGGG - Intergenic
1019758307 7:2789524-2789546 CTCACCTATGGGGAGTAGTGAGG - Intronic
1024574196 7:50750846-50750868 CTGACCAGTGGTGAGTTATCTGG - Intronic
1026107792 7:67434645-67434667 CTCCCCAGAGGTGAGGAGTAAGG + Intergenic
1029167387 7:98602348-98602370 TGCACCAGTGTTGAGAAGTGGGG + Intergenic
1030060487 7:105617494-105617516 CTATCCACTTGTGAGTAGTGAGG - Intronic
1030882032 7:114892153-114892175 CACACCAGTGGGCAGCAGTGAGG - Intergenic
1032778649 7:135143714-135143736 CTCCCCAGTGGTGGGCAGGGAGG + Intronic
1037559746 8:20062193-20062215 CATACCAGTGGTGAGAAGGGAGG - Intergenic
1039031066 8:33310200-33310222 CTCAGCAGCTGTGAGTGGTGTGG - Intergenic
1040906722 8:52476699-52476721 CTCACAAGAAGTGAGAAGTGGGG + Intergenic
1047786567 8:128159210-128159232 TTCCCCAGAGGTGACTAGTGGGG - Intergenic
1048930603 8:139312534-139312556 CAAATCTGTGGTGAGTAGTGGGG - Intergenic
1051460565 9:17309235-17309257 CTCACCTGTGCTGAGTAGTCTGG - Exonic
1051921969 9:22277048-22277070 CTGAGGAGTGGTGAGTGGTGAGG + Intergenic
1054159562 9:61664381-61664403 CGGACCAGTGGTTAGTAGGGTGG + Intergenic
1054174191 9:61863744-61863766 CGGACCAGTGGTTAGTAGCGTGG - Intergenic
1054449049 9:65392811-65392833 CGGACCAGTGGTTAGTAGCGTGG - Intergenic
1054663346 9:67717037-67717059 CGGACCAGTGGTTAGTAGCGTGG + Intergenic
1055396487 9:75880565-75880587 CACACCAGTAGTGAGTGATGGGG - Intergenic
1056375763 9:86009437-86009459 ATAACCAATGGTGAGGAGTGGGG + Intronic
1061946808 9:133913142-133913164 CTCACCAGAGGTGGGTGTTGGGG - Intronic
1186846492 X:13535850-13535872 CTCTCCAGTGGTGAGGGCTGGGG - Intergenic
1190572860 X:51802351-51802373 CTCCCCTGTGGTGAGAATTGTGG + Intergenic
1192012907 X:67294139-67294161 CTCATCAGTGTTAAATAGTGTGG - Intergenic
1194065376 X:89253996-89254018 CTCACTGGTGGTGACTACTGAGG + Intergenic
1196245278 X:113392168-113392190 CTGCCCAGTGATGAGTAGTGGGG + Intergenic
1196265278 X:113636560-113636582 ATCACCTGTGGTCAGGAGTGTGG + Intergenic
1196550721 X:117021154-117021176 CAGACCAGTAATGAGTAGTGAGG + Intergenic
1200719545 Y:6588080-6588102 CTCACTGGTGGTGACTACTGAGG + Intergenic
1201949580 Y:19549311-19549333 CTCATCTGTAGTGAGTAGTGGGG + Intergenic