ID: 930030476

View in Genome Browser
Species Human (GRCh38)
Location 2:47055580-47055602
Sequence GAGCCGTGACCTGGGATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930030476_930030483 -6 Left 930030476 2:47055580-47055602 CCCATGATCCCAGGTCACGGCTC 0: 1
1: 0
2: 1
3: 4
4: 72
Right 930030483 2:47055597-47055619 CGGCTCTGGGAGCTGACAGTGGG 0: 1
1: 0
2: 3
3: 20
4: 185
930030476_930030482 -7 Left 930030476 2:47055580-47055602 CCCATGATCCCAGGTCACGGCTC 0: 1
1: 0
2: 1
3: 4
4: 72
Right 930030482 2:47055596-47055618 ACGGCTCTGGGAGCTGACAGTGG 0: 1
1: 0
2: 0
3: 10
4: 202
930030476_930030487 18 Left 930030476 2:47055580-47055602 CCCATGATCCCAGGTCACGGCTC 0: 1
1: 0
2: 1
3: 4
4: 72
Right 930030487 2:47055621-47055643 CAGAGCAGGAGACGCATGTAGGG 0: 1
1: 0
2: 0
3: 18
4: 148
930030476_930030484 4 Left 930030476 2:47055580-47055602 CCCATGATCCCAGGTCACGGCTC 0: 1
1: 0
2: 1
3: 4
4: 72
Right 930030484 2:47055607-47055629 AGCTGACAGTGGGCCAGAGCAGG 0: 1
1: 0
2: 3
3: 27
4: 314
930030476_930030486 17 Left 930030476 2:47055580-47055602 CCCATGATCCCAGGTCACGGCTC 0: 1
1: 0
2: 1
3: 4
4: 72
Right 930030486 2:47055620-47055642 CCAGAGCAGGAGACGCATGTAGG 0: 1
1: 0
2: 0
3: 9
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930030476 Original CRISPR GAGCCGTGACCTGGGATCAT GGG (reversed) Intronic
901803034 1:11720233-11720255 GAGCACTGACCTGGGACCCTGGG - Exonic
902079652 1:13812349-13812371 GAGCAGTGTGCTGTGATCATGGG - Intronic
906278676 1:44537691-44537713 GAACCCTGACTTGTGATCATTGG - Intronic
908009770 1:59764269-59764291 GAGCCCTGGCCTGGGATCCTAGG + Intronic
915755330 1:158254269-158254291 GAGCAGGGACATGGGAGCATTGG + Exonic
916666273 1:166970575-166970597 GAGCCCTGACCTGGGAGCTGAGG - Intronic
916707752 1:167370217-167370239 AAGCTGGGACCTGGGATTATGGG + Intronic
920741088 1:208581920-208581942 GAGCAGTGACCTGTGATTGTTGG - Intergenic
922122891 1:222691138-222691160 GAGCCATGACCTAGGATGAGAGG + Intronic
922741052 1:228014421-228014443 GAGCCGTGCCCTTGGTACATGGG + Intronic
1066244759 10:33571642-33571664 GAGCAGGAACCTGTGATCATGGG + Intergenic
1071511759 10:86266577-86266599 CATCACTGACCTGGGATCATGGG - Intronic
1072536825 10:96370471-96370493 GAGCCCTGACCTGGGAGCCAGGG - Intronic
1074464110 10:113666807-113666829 GAGCCTTGATCTGGGAACTTCGG + Intergenic
1076005125 10:126942626-126942648 GAGCCGTCATCTGGGACCCTGGG + Intronic
1076861919 10:133141782-133141804 GAGCTGGGACCTGTGAGCATTGG + Intergenic
1080658926 11:34280309-34280331 GAGCCATGGCCTGGGAACCTGGG - Intronic
1083720719 11:64602261-64602283 GAGCTGGGACATGGGGTCATGGG - Exonic
1084514874 11:69631510-69631532 GAGCTGAGACTTGGGATGATTGG - Intergenic
1084676895 11:70640605-70640627 GAGCCCTGACCTGGGATCACAGG + Intronic
1090863780 11:130676975-130676997 GAGCCATGACTTGGGTTGATGGG + Intronic
1095088645 12:38084715-38084737 GAGTGGTGACCTGGGAGAATGGG - Intergenic
1105864948 13:24451185-24451207 GAGCCCTGACCTGGGAGCAGGGG + Intronic
1107925903 13:45261561-45261583 GCGCAGTGATCTGTGATCATTGG + Intronic
1121829125 14:97034313-97034335 GAGCCGTGGCTTGGGGTCAAAGG + Intergenic
1124999257 15:34754282-34754304 GAGCCTTGACCTAGGACGATGGG + Intronic
1129591146 15:76916239-76916261 GAGCCTAGACCTGGGAGCTTTGG + Intergenic
1133284663 16:4685000-4685022 GAGCAGTGGCCTGTGCTCATGGG + Intronic
1136028222 16:27483783-27483805 TAGGCAGGACCTGGGATCATTGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1138537906 16:57669465-57669487 CAGCTGTGACCAGGGCTCATGGG + Intronic
1139371659 16:66472936-66472958 AAGCCTTGACCTGGGCTCAAGGG - Intronic
1139775676 16:69315727-69315749 GAGCCCTGACCTGAGATATTAGG + Intronic
1142706439 17:1697920-1697942 GTGCCCTGACCTGGGATCTGAGG + Intergenic
1151872340 17:76844802-76844824 GACCTGTGACCTGGGATGCTGGG + Intergenic
1156901360 18:42303844-42303866 GAGCCCTGGGCTGGGATCAAGGG - Intergenic
1158327922 18:56330149-56330171 GAGGCCTGAGCTGGGATGATAGG - Intergenic
1158934232 18:62349675-62349697 GGGGGGTGTCCTGGGATCATGGG + Intronic
1159059782 18:63502481-63502503 GAGCCATGCCCTAGGGTCATAGG - Intronic
927640395 2:24841947-24841969 GAGCCCTGACCTGTGATTCTAGG - Intronic
930030476 2:47055580-47055602 GAGCCGTGACCTGGGATCATGGG - Intronic
937480736 2:122256153-122256175 GAACCCTGACCTTGGATTATTGG + Intergenic
947403896 2:229755100-229755122 CAGCCATGACCTTGGATGATGGG + Intergenic
1183748233 22:39704502-39704524 GGGCCGTGATCTTGAATCATGGG + Intergenic
950527566 3:13533287-13533309 GTGCTGTGTCCTGGGCTCATCGG - Intergenic
953432705 3:42852895-42852917 GTGCCGTGATCTGGAATCAGAGG + Intronic
959016426 3:101139242-101139264 GTGCAGTAACCTGGGATCAGTGG - Intergenic
963148953 3:142023882-142023904 CAGCCCTGACCTGGGCTCAAGGG + Intronic
970103762 4:12556584-12556606 GAGCGGTGACCTCGTTTCATTGG - Intergenic
971597222 4:28546039-28546061 AACCAGTGACCTGGGATCACTGG + Intergenic
973655343 4:53042021-53042043 GAGCCAGGACCTGGTCTCATGGG + Intronic
978385878 4:108175096-108175118 GAGCCATTTCCTGGGCTCATTGG + Intergenic
987403707 5:17503332-17503354 CAGCTGTGACCTGGGTTCAGTGG - Intergenic
997580830 5:135015833-135015855 GAGCCCTTAGCTGGGATCAGGGG + Intergenic
997888777 5:137657078-137657100 GCTCCTTGACCTTGGATCATGGG - Intronic
1000984950 5:167856150-167856172 GACCCGTTTTCTGGGATCATAGG + Intronic
1001963032 5:175892021-175892043 GAGATAAGACCTGGGATCATGGG - Intergenic
1002471649 5:179439214-179439236 GTGCCCTGCCCTGGGATCCTGGG - Intergenic
1004560457 6:16744495-16744517 GAGCCCTGTCCTGGGAGCAGTGG - Intronic
1008251035 6:49240127-49240149 GAGAGGTGACCTGGGATTCTAGG + Intergenic
1011624581 6:89272691-89272713 GAGCCCTGACCAGGGAACACAGG + Intronic
1012228732 6:96736019-96736041 TAGTCGTGACCTGGGATAAATGG - Intergenic
1026280512 7:68918126-68918148 CAGCAGTGACCTGGGATACTGGG - Intergenic
1032273452 7:130432677-130432699 CAGCCTTGACCTGGGCTCAAGGG - Intronic
1035361513 7:158316665-158316687 GAGCCGGGCGCTGGGCTCATGGG - Intronic
1038686046 8:29719312-29719334 GAGCTGAGTCCTGGGATCCTGGG + Intergenic
1047759918 8:127946846-127946868 GAGTCGTGACCTTGGGTCAAAGG - Intergenic
1048664028 8:136641108-136641130 GAGCCCTAACCTAGGATCATGGG - Intergenic
1053466474 9:38312196-38312218 GAGCCGTGACCTGGGAGGCGGGG - Intergenic
1055474000 9:76643435-76643457 GAGATGTGACCTGGGAAGATGGG + Intronic
1058630479 9:106981401-106981423 AAGCTGTGACCTGGGAACACAGG - Intronic
1059281499 9:113137987-113138009 GAGCGCTGGCCTGGGATCAAGGG - Intergenic
1061217044 9:129227514-129227536 GAGCCTAGACCTGGGAGCAGGGG + Intergenic
1185595712 X:1305545-1305567 GAGCAGTGACCTGGGATGGAAGG + Intronic
1186782178 X:12924221-12924243 GTGCAGAGACCTTGGATCATTGG + Intergenic
1186987778 X:15035728-15035750 CTGACATGACCTGGGATCATTGG - Intergenic
1189695864 X:43661204-43661226 AAGCAGTGACTGGGGATCATGGG + Intronic
1200919371 Y:8599493-8599515 CTGCCCTGTCCTGGGATCATGGG - Intergenic