ID: 930031773

View in Genome Browser
Species Human (GRCh38)
Location 2:47062540-47062562
Sequence CACTGCCCTAATCAAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930031773_930031780 -8 Left 930031773 2:47062540-47062562 CCAGAAACTTGATTAGGGCAGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 930031780 2:47062555-47062577 GGGCAGTGGGAGGGAGGGTGTGG 0: 1
1: 2
2: 31
3: 316
4: 2511
930031773_930031783 6 Left 930031773 2:47062540-47062562 CCAGAAACTTGATTAGGGCAGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 930031783 2:47062569-47062591 AGGGTGTGGGCTATATCATTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
930031773_930031781 -7 Left 930031773 2:47062540-47062562 CCAGAAACTTGATTAGGGCAGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 930031781 2:47062556-47062578 GGCAGTGGGAGGGAGGGTGTGGG 0: 1
1: 0
2: 15
3: 168
4: 1319
930031773_930031782 5 Left 930031773 2:47062540-47062562 CCAGAAACTTGATTAGGGCAGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 930031782 2:47062568-47062590 GAGGGTGTGGGCTATATCATTGG 0: 1
1: 0
2: 1
3: 7
4: 96
930031773_930031784 18 Left 930031773 2:47062540-47062562 CCAGAAACTTGATTAGGGCAGTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 930031784 2:47062581-47062603 ATATCATTGGGCCTGCAGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930031773 Original CRISPR CACTGCCCTAATCAAGTTTC TGG (reversed) Intronic
901297222 1:8169880-8169902 CACTGGCCTAAACCAGTTTACGG - Intergenic
903684411 1:25120289-25120311 TAATACCATAATCAAGTTTCTGG - Intergenic
907314267 1:53558582-53558604 CACTGCCCTTCTCCAGTGTCTGG + Intronic
907741842 1:57173966-57173988 CACTGCCCTTATGAAGTCCCTGG + Intronic
911417297 1:97590696-97590718 CACTTTGGTAATCAAGTTTCAGG + Intronic
912118564 1:106439196-106439218 CACTGTCCTAAGCAAGGTTAAGG - Intergenic
920073355 1:203319483-203319505 CACTGCCCTCTTCTAGTTACTGG - Intergenic
921653457 1:217706277-217706299 CACTGCCCAAAGCAATTTACAGG - Intronic
1067793060 10:49302087-49302109 CCCTGCCCTCCTCAAGCTTCAGG - Intronic
1069661491 10:70126496-70126518 CACTGCCCTGATCATCTTTGCGG + Intronic
1074958567 10:118417420-118417442 CATTGACCTAATCAAGTTAATGG - Intergenic
1076314912 10:129533163-129533185 CACAGCCAAAATCAAGCTTCAGG - Intronic
1077538840 11:3137093-3137115 CATTGACCTTAGCAAGTTTCTGG - Intronic
1078279012 11:9880664-9880686 CACTGCCCTACTCAAGAGTATGG + Intronic
1082713502 11:56584609-56584631 CACTGTCCTTACCAAGATTCAGG - Intergenic
1083087200 11:60161676-60161698 CTCTGCCCTAATCAAAGTTGTGG - Intergenic
1085086565 11:73671795-73671817 CACTGCCCTAGTAAAGGCTCCGG + Intergenic
1089784921 11:120901026-120901048 CCCTGCCCTAATCCAGGATCGGG + Intronic
1092025936 12:5240499-5240521 GATTGACCTGATCAAGTTTCAGG + Intergenic
1095616073 12:44190689-44190711 CCCAGCCCTCATCCAGTTTCTGG + Intronic
1098722352 12:73916895-73916917 ACCTGCCCTAAGCAAGTTACTGG + Intergenic
1099695505 12:86014185-86014207 CACTGCCATAATCAAAGTTCCGG + Intronic
1101841324 12:108329315-108329337 CCCTGCACTCATCAAGTCTCTGG + Intronic
1102798567 12:115711267-115711289 CACTGATCAAATCAAGTTTCTGG + Intergenic
1104199543 12:126574968-126574990 CACAGCCTTAATTGAGTTTCCGG + Intergenic
1108228480 13:48315110-48315132 CACTGCCCAAAGCAATTTACAGG - Intronic
1108400546 13:50037808-50037830 AACTGGGCAAATCAAGTTTCAGG - Intergenic
1111998416 13:95187934-95187956 CACTGCCCTCCAGAAGTTTCTGG - Intronic
1114495761 14:23131050-23131072 CACTTCCCCCATCAAGCTTCAGG - Intronic
1119194627 14:72708377-72708399 CGCTCCACAAATCAAGTTTCTGG + Intronic
1121015866 14:90548712-90548734 TGCTGCTCTCATCAAGTTTCTGG - Intronic
1121026990 14:90623638-90623660 TGCAGCCCTACTCAAGTTTCAGG - Intronic
1121234686 14:92383629-92383651 CTCTGCCCTCAGCAAGTTACCGG - Intronic
1124500607 15:30224289-30224311 CACTGCCCTCATCCAGTCGCTGG + Intergenic
1124742965 15:32314378-32314400 CACTGCCCTCATCCAGTCGCTGG - Intergenic
1126639922 15:50813757-50813779 CACTGCCTTATACAATTTTCTGG - Intergenic
1127588704 15:60401292-60401314 CATTGCCCTACTCAAGTTTTTGG + Intronic
1129109572 15:73329602-73329624 CACTGCCCTCATCCAGTCCCTGG - Exonic
1130337874 15:82973023-82973045 CACTGCTCTACTCCAGCTTCAGG + Intronic
1133964063 16:10518769-10518791 CACTTCTCTAACCATGTTTCAGG + Intergenic
1142855742 17:2728730-2728752 AACTGTCCTAATCTAGTGTCTGG + Intergenic
1153258219 18:3194609-3194631 CACTTCCCTAGTCAATTTTTTGG - Intronic
1156318024 18:35989288-35989310 CACTGCTCTAAACAAATTCCAGG - Intronic
1156816848 18:41321663-41321685 CACTGCCCCAATCATCTTTTGGG - Intergenic
1157924767 18:51751680-51751702 CACTGGCCAAATCAAGTCACGGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160723593 19:608131-608153 CACTGCCCTCATCCAGTCGCTGG + Exonic
930031773 2:47062540-47062562 CACTGCCCTAATCAAGTTTCTGG - Intronic
938086558 2:128405792-128405814 CACTGCCCAAATCACATTGCTGG - Intergenic
941704847 2:168647104-168647126 CACTGCCCAAATCAATTTACCGG - Intronic
941998439 2:171623452-171623474 CATTGCCCTAAACAATTGTCAGG + Intergenic
944154306 2:196593853-196593875 CACTCCCCTATTCAGCTTTCTGG - Intergenic
944645064 2:201771419-201771441 CATTGCCCTATTGGAGTTTCAGG - Intronic
946272449 2:218605650-218605672 TACTGCCCTGATCAGGTTTCTGG + Intergenic
1170916447 20:20631235-20631257 AACTGCCCTCATCAAGTAGCAGG + Intronic
1171052556 20:21873600-21873622 CACTGCCCTCAGCAAGTCCCAGG + Intergenic
1173504558 20:43576632-43576654 CTCTGCCCTTATTAAGTTTGGGG + Intronic
1174082460 20:47980198-47980220 CCCTGCCCTAAGCATTTTTCTGG + Intergenic
1174891691 20:54402212-54402234 CACAGTCCTAATAAATTTTCTGG - Intergenic
1177724786 21:24953283-24953305 CACCGCACCAATCAACTTTCGGG - Intergenic
1177783417 21:25643596-25643618 AACTGCCATAATCAATTTGCTGG + Intronic
953742180 3:45547497-45547519 AACTGCCCTCATCAACTTCCTGG + Exonic
954938209 3:54346261-54346283 CACTGCTCTCATCCAGTGTCTGG + Intronic
963524338 3:146397210-146397232 CAATACCCTAATCCTGTTTCTGG - Intronic
966136242 3:176701591-176701613 CAAAGGTCTAATCAAGTTTCCGG + Intergenic
978515777 4:109567213-109567235 CACTGCCCAAATCACATTTCTGG + Intronic
978542433 4:109832381-109832403 TACCACCTTAATCAAGTTTCTGG - Intronic
979270676 4:118756991-118757013 CACAGCCCAAAACAAATTTCAGG - Intronic
984852982 4:184169559-184169581 CTCTGCCGTCATCACGTTTCTGG + Intronic
991948114 5:71920670-71920692 CCCTGCCCTTATCCAGATTCAGG - Intergenic
992212252 5:74492512-74492534 AATTGCACTAATCAAGATTCTGG + Intergenic
992909307 5:81379679-81379701 CATTACCCTACTCAGGTTTCTGG + Intronic
995021371 5:107370837-107370859 CTCTGCCCTGATCAAGTTTGTGG - Intergenic
995079652 5:108034424-108034446 CAGAGTCCTAATCCAGTTTCTGG - Intronic
995468805 5:112478824-112478846 CACTGCCCCAGTCATGTTTCTGG + Intergenic
999255932 5:150210060-150210082 CCCTGCCCAACTCAAGATTCTGG - Exonic
1000407412 5:160903173-160903195 CATAGCCCTAAGCACGTTTCTGG - Intergenic
1002147176 5:177193575-177193597 GACAGCTCAAATCAAGTTTCAGG - Intronic
1003529186 6:6923777-6923799 AACTGACCAAATCCAGTTTCAGG + Intergenic
1006798402 6:36744873-36744895 CACTGCCCTCATCCACCTTCTGG - Intronic
1007755945 6:44099658-44099680 CACAACCCTTAGCAAGTTTCAGG + Intergenic
1009320727 6:62285786-62285808 CACTCCCCTAATCAAGCCGCGGG + Intronic
1011763593 6:90594668-90594690 AACTGCCCTAGTCAAGGTTATGG - Intergenic
1016645929 6:146408177-146408199 CAGTGCCCTAATGAAGATACAGG - Intronic
1018508027 6:164492410-164492432 AAATGCCTTTATCAAGTTTCAGG - Intergenic
1019097004 6:169590286-169590308 CACTACCATTGTCAAGTTTCAGG - Intronic
1030528825 7:110686727-110686749 CACTGCCCTCATCAAGGAACAGG + Intronic
1031995863 7:128230503-128230525 CACTGCCCTAGTCAGGTTGGGGG + Intergenic
1033509592 7:142041833-142041855 CACTGCCACTTTCAAGTTTCTGG + Intronic
1037401122 8:18496305-18496327 CACTGACCTACCCAAGTTGCAGG - Intergenic
1041824796 8:62082512-62082534 CACTGCCCTAATGAAGATTGAGG - Intergenic
1042855588 8:73263725-73263747 GACTGCCCCAATTAAGCTTCAGG - Intergenic
1047435134 8:124829786-124829808 CTCTGCCTTAGTCTAGTTTCTGG - Intergenic
1050447569 9:5741413-5741435 CTCTCCCCTAATCTATTTTCTGG + Intronic
1051366469 9:16324754-16324776 CACTTCCCTGCTCAAGCTTCTGG + Intergenic
1051440661 9:17079288-17079310 CACAGCCCTGATCTATTTTCAGG - Intergenic
1052368270 9:27638140-27638162 CACATCCCCAACCAAGTTTCAGG - Intergenic
1053184021 9:35999670-35999692 GACTGCCCTCATCAAGATTTAGG + Intergenic
1058406763 9:104685325-104685347 GACTGCTCCAATCCAGTTTCTGG - Intergenic
1061953433 9:133949223-133949245 CCCTGCCCTTAGCAAGCTTCCGG + Intronic
1195179977 X:102348776-102348798 TACTGCCCTAAGCAATTTGCAGG - Intergenic
1196263021 X:113608002-113608024 CATTGCCCTAATCTAATTTTTGG + Intergenic
1197203911 X:123773385-123773407 CCCTGCCCTGATCAGGTTCCAGG + Intergenic
1199599267 X:149532072-149532094 CACTGGGCAAATCAACTTTCTGG + Intronic
1202033319 Y:20602990-20603012 CACTGCCGAAATCAATTTACAGG - Intergenic