ID: 930034070

View in Genome Browser
Species Human (GRCh38)
Location 2:47074778-47074800
Sequence CTCAGGCAGGGGAAGCCAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 381}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930034070_930034075 -8 Left 930034070 2:47074778-47074800 CCTTTTGGCTTCCCCTGCCTGAG 0: 1
1: 1
2: 2
3: 33
4: 381
Right 930034075 2:47074793-47074815 TGCCTGAGAGAGACCTGAGGAGG 0: 1
1: 0
2: 6
3: 35
4: 300
930034070_930034076 -7 Left 930034070 2:47074778-47074800 CCTTTTGGCTTCCCCTGCCTGAG 0: 1
1: 1
2: 2
3: 33
4: 381
Right 930034076 2:47074794-47074816 GCCTGAGAGAGACCTGAGGAGGG 0: 1
1: 0
2: 3
3: 30
4: 376
930034070_930034080 19 Left 930034070 2:47074778-47074800 CCTTTTGGCTTCCCCTGCCTGAG 0: 1
1: 1
2: 2
3: 33
4: 381
Right 930034080 2:47074820-47074842 AGAGCCCAGCCCCTCTCCTGTGG 0: 2
1: 1
2: 4
3: 57
4: 370
930034070_930034084 28 Left 930034070 2:47074778-47074800 CCTTTTGGCTTCCCCTGCCTGAG 0: 1
1: 1
2: 2
3: 33
4: 381
Right 930034084 2:47074829-47074851 CCCCTCTCCTGTGGCTGAGCAGG 0: 2
1: 2
2: 9
3: 89
4: 799
930034070_930034078 -6 Left 930034070 2:47074778-47074800 CCTTTTGGCTTCCCCTGCCTGAG 0: 1
1: 1
2: 2
3: 33
4: 381
Right 930034078 2:47074795-47074817 CCTGAGAGAGACCTGAGGAGGGG 0: 1
1: 0
2: 3
3: 43
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930034070 Original CRISPR CTCAGGCAGGGGAAGCCAAA AGG (reversed) Exonic
901423265 1:9164951-9164973 CCCATGCAGGGGCAGCCAAGTGG - Intergenic
901758237 1:11454310-11454332 CCCAGGCTGGGGAAGGAAAACGG + Intergenic
901927043 1:12572941-12572963 CTCAGACAGGAAAAGCCAAAGGG - Intronic
903033755 1:20481338-20481360 CCCAGGCAGTGGAGGCCCAAGGG - Intergenic
903221757 1:21873274-21873296 CTCGGACAGGCAAAGCCAAAGGG + Intronic
903240945 1:21982228-21982250 CGCAGGCAGGTGAAGACAGAGGG + Intronic
903288414 1:22291654-22291676 CTCAGGCAGAGTAAGCCCAGAGG + Intergenic
904008216 1:27374771-27374793 CCCAAGCAGGAGAAGCCACAGGG + Exonic
904401169 1:30257667-30257689 CTCAGGAAGGGGAACCCAGGTGG - Intergenic
904455016 1:30642305-30642327 CTCAGGAAGGGGAACCCAGGTGG - Intergenic
904624731 1:31796100-31796122 CTCAGACCTGGGAAGCCAACGGG - Intronic
904862146 1:33546431-33546453 CACAGGGAGGGGAAGCAAGAAGG + Intronic
905259578 1:36707989-36708011 TTGAGGCAGGGAGAGCCAAAGGG - Intergenic
905395217 1:37662373-37662395 CACAGGCAGAGGAAGTGAAAAGG + Intergenic
905646317 1:39626968-39626990 GCCAGGCAGGGAAGGCCAAAGGG + Exonic
905812560 1:40923309-40923331 CTCAGGCAGGGGGAACCATCAGG + Intergenic
905950492 1:41946645-41946667 CTCAAGCAGGGGACAGCAAATGG - Intronic
906512821 1:46420805-46420827 CTCAGGAAGGTGAAGCCACTTGG + Intergenic
906766847 1:48441531-48441553 CTCAAGCAGGGGACAACAAATGG - Intronic
907148340 1:52257822-52257844 CTGAGGCAGGAGAACCCAAGAGG - Intronic
907897008 1:58701481-58701503 CTAAGGCAGGGGAATGCAGAAGG - Intergenic
908522148 1:64954604-64954626 CACAGGTTGGGGAAACCAAAGGG + Intronic
908614804 1:65907960-65907982 CTGAGGCAGAGGCAGCCAGATGG + Intronic
909176877 1:72371940-72371962 CTCAGGGAGAGGAAACAAAAAGG - Intergenic
909531629 1:76688385-76688407 CTCAGGCAGGAGCATACAAATGG + Intergenic
910214589 1:84830323-84830345 CAGAGACAGGGCAAGCCAAAGGG + Intronic
912463816 1:109855522-109855544 CTCAAGCAGGGGACAACAAACGG + Intergenic
913226897 1:116708400-116708422 CTCAGGGACTGGAAGCAAAATGG + Intergenic
913468911 1:119171177-119171199 CTCAAGCAGGGGACAACAAATGG + Intergenic
914746987 1:150508379-150508401 CTCAGAAAAGGAAAGCCAAACGG - Intronic
914913368 1:151803638-151803660 CTCAGGCAGCTCAGGCCAAAAGG - Intronic
915218128 1:154353363-154353385 CCCAGGCAGGGGAAAGGAAAGGG - Intergenic
916083839 1:161253941-161253963 CTCAAGCAGGGGACAACAAATGG - Intergenic
916731665 1:167572126-167572148 CCCAGCCAAGGGAAGCCATAAGG - Intergenic
917203575 1:172544435-172544457 CTCAGGTAGAGATAGCCAAAGGG + Intronic
917280047 1:173371402-173371424 CTCAAGCAGGGGACAACAAATGG - Intergenic
917281329 1:173380306-173380328 CTCAAGCAGGGGACTACAAATGG - Intergenic
917676418 1:177323043-177323065 CTCAAGCAGGGGACAACAAATGG - Intergenic
917759460 1:178140954-178140976 CTCAGGAAGCGGAAGGCAGAAGG + Intronic
919708672 1:200704511-200704533 CTGAGGAAGGGGAAGACATAAGG - Intergenic
919983429 1:202656887-202656909 GTCTGGCAGTGGAAGCCACAGGG - Intronic
920034714 1:203058431-203058453 CACAGACAGGGGAAGCTGAACGG + Intronic
920593878 1:207249171-207249193 CACAGGCAGGGGGAGTCAAAAGG + Intergenic
920727015 1:208445763-208445785 CCCAGGTAGTGGAAGACAAAGGG - Intergenic
920992195 1:210950151-210950173 CCCAGGCAGGGGAGGGCAAGTGG + Intronic
921092756 1:211858790-211858812 CTCAAGCAGGGGAAAACAAATGG - Intergenic
922032412 1:221814044-221814066 CTCAGACAGGGAAATACAAAGGG - Intergenic
922253482 1:223871372-223871394 CGCAGCCAGGGGAAGCCATGAGG - Intergenic
922977022 1:229793606-229793628 CACAGGCTGGGGAAGGCAAGGGG + Intergenic
923347457 1:233068572-233068594 TACAAGCAGGGGAAGCTAAATGG + Intronic
924953882 1:248909183-248909205 CTCAGGCAGGGCAAGAAAGATGG + Intronic
1064603397 10:17015304-17015326 CTCAAGTAGGGGAAAACAAATGG + Intronic
1065199460 10:23299435-23299457 CTCAAGCAGGGGACAACAAATGG + Intronic
1065421455 10:25549259-25549281 CTTAGGAGGGGGAAGACAAATGG - Intronic
1065679826 10:28217684-28217706 ATGAGGCAGGGGAAGGGAAAAGG + Intronic
1066145484 10:32553897-32553919 CCCTGGTAGGGGAAGACAAAGGG - Intronic
1066171492 10:32852570-32852592 CTAAGGCAGGAGAACCCAGAAGG - Intronic
1066421960 10:35271916-35271938 CTCAGGCAGCTGAAGCCAAATGG + Intronic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1067792568 10:49299200-49299222 CCCAGCCGGGGGAAACCAAATGG - Exonic
1067793351 10:49303850-49303872 CTCAGCCAGGGGAAGGAAAGGGG - Intronic
1068248349 10:54403597-54403619 CTCAGGCAAGGGAAAGAAAAAGG + Intronic
1068404785 10:56574681-56574703 CTCAAGCAGGGGACTACAAATGG + Intergenic
1069120885 10:64567725-64567747 CCCAGCCAGAGGAAGCCATAAGG - Intergenic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1069364918 10:67686896-67686918 CTCAAGCAGGGGACAACAAATGG + Intronic
1069642351 10:69964053-69964075 CTCAGGTAGGGGAGGACAAGTGG + Intronic
1070676291 10:78413855-78413877 CACAGGGAGGGGGACCCAAATGG + Intergenic
1071565719 10:86670418-86670440 CCCAGGCAGGGGAGGCCACAGGG - Intronic
1072148695 10:92667278-92667300 CTAAGGCATGGGTAGGCAAAAGG - Intergenic
1072281972 10:93873881-93873903 CTCAGTCAGGGGAGGTCAGAGGG + Intergenic
1072757021 10:98028394-98028416 CTGAGGCGGTGGAAGCCTAAAGG - Intronic
1072834292 10:98694824-98694846 CCCAGGCACAGGAAACCAAAAGG + Intronic
1073509791 10:104035585-104035607 ATCAGGCAGGGGGAGGCAGATGG + Intronic
1073567810 10:104550370-104550392 CTCAGGCAGGTGGGGCCAAGAGG - Intergenic
1073616196 10:104998708-104998730 CTCAGGCAGAGGAGGCCAGCTGG + Intronic
1074264596 10:111888950-111888972 CTCAGGAAGGAGCAGCCAACTGG + Intergenic
1074704491 10:116118932-116118954 CTCCAGCAGGGGCAGACAAATGG + Intronic
1074957440 10:118406154-118406176 CACAGACCTGGGAAGCCAAAGGG - Intergenic
1075961178 10:126568746-126568768 CTCAGAGTGGGGAAGCCAAGGGG + Intronic
1076370817 10:129951990-129952012 CTGAGCCCGGCGAAGCCAAATGG + Intronic
1077506604 11:2932488-2932510 CTCAGGCAAGGGAGGCCGAGCGG - Intergenic
1078118132 11:8476542-8476564 CCCAGGCAGAGGAAGCAGAAGGG - Intronic
1078673336 11:13385098-13385120 CTCAGCCAGGGGAAGGCAGCTGG + Intronic
1080572045 11:33565521-33565543 CTCAGGAAGGGGAAGCCAGGAGG + Intronic
1085121124 11:73968323-73968345 CCTGGGCAGGGGACGCCAAAAGG - Exonic
1085176397 11:74492362-74492384 CTCCTGCAAGGCAAGCCAAAGGG + Exonic
1085535565 11:77215256-77215278 CTCAGGGAGGGGAAGTGGAAGGG + Intergenic
1085601665 11:77861159-77861181 CTCAAGCAGGGGACAACAAATGG + Intronic
1088206437 11:107397584-107397606 CTCTGGTAGTGGAAGACAAAGGG + Intronic
1089670909 11:120056444-120056466 CTCAGGCAGGAGAGGCCAATGGG - Intergenic
1091791119 12:3272762-3272784 CTCAGGACGGGGAAGCCCGAAGG + Intronic
1093172591 12:15876112-15876134 CCCAGGTAGTGGAAGACAAAGGG + Intronic
1093336578 12:17912368-17912390 CTCAGGCAGTGGGAACCCAAAGG + Intergenic
1093349252 12:18077203-18077225 CTGAGGAAGGGAATGCCAAAGGG - Intergenic
1093749566 12:22782665-22782687 CTCAGGAAAGAGAAGCCAAGTGG + Intergenic
1095134996 12:38589828-38589850 CTGAGGCAGGAGAACCCAGAAGG - Intergenic
1095881167 12:47138255-47138277 CTCAAACATGGGAAGACAAAGGG + Intronic
1097007727 12:55931265-55931287 TCCAGGCAGGGGAAGCTGAAAGG + Exonic
1097193359 12:57230870-57230892 CTCAGACTGGGGAAGCAAACAGG + Exonic
1097287667 12:57890030-57890052 GTGAGGCAGGGGAGGCCAGAGGG + Intergenic
1098543783 12:71688326-71688348 CTGAGGCAGGAGAAACCAGAAGG - Intronic
1099310991 12:81022632-81022654 CTCACCAAGGGGAAGCCAAACGG - Intronic
1100092318 12:90986139-90986161 CTCAAGCAGGGGACAACAAATGG - Intronic
1102221367 12:111197099-111197121 CTCAGGCTTGGGAAGCAACAGGG - Intronic
1103057701 12:117834674-117834696 CTCAGGCTGGGGAAGCACAGGGG - Intronic
1103344770 12:120241859-120241881 CTCAGGCAGGGGAGATCAGAGGG + Intronic
1104705257 12:130940545-130940567 CCCAGGCAGGGGAAACAAGATGG + Intergenic
1104851437 12:131876816-131876838 CTCAAGCAGGGGACAACAAACGG + Intergenic
1105706658 13:22971554-22971576 CCCAAGCACGGGAAGCCAAAAGG + Intergenic
1106257123 13:28031894-28031916 CTCAGTATGGAGAAGCCAAAGGG + Intronic
1107415654 13:40197777-40197799 CTCATGCAGGTGAAGATAAAAGG + Intergenic
1108469769 13:50756291-50756313 CTCTGGCAGCTGAAGACAAAGGG - Intronic
1109162927 13:58998655-58998677 CTCAGCAAGGGGAAAACAAAAGG + Intergenic
1109298199 13:60561460-60561482 GTGAGGAAGAGGAAGCCAAAGGG + Intronic
1109511475 13:63380400-63380422 CTCAGACAGTGGAAGTCACAAGG - Intergenic
1110804242 13:79736303-79736325 CTCAGGCTGGGGAAGGAAAAAGG - Intergenic
1111997517 13:95179326-95179348 CCCAGTCAGGAAAAGCCAAAGGG + Intronic
1112191967 13:97186981-97187003 ATAAGGCAGGGGAAGCCAGTGGG - Intergenic
1113108583 13:106797960-106797982 CCCAGGCAGGGGACTCCACAAGG + Intergenic
1114139490 14:19894433-19894455 TTTAGGCAGTGGAAGCCCAAGGG + Intergenic
1114384415 14:22240821-22240843 CTCAAGCAGGGGACAACAAATGG - Intergenic
1114508955 14:23240695-23240717 GTCTGGCAGGGAAAGCCACAAGG + Intronic
1115103737 14:29734832-29734854 CTCAGGGAGGCCAAGCCAACAGG - Intronic
1115722540 14:36178539-36178561 CTGAGGCCTGGGGAGCCAAAAGG + Intergenic
1117328630 14:54691156-54691178 CTCAGGCAGGGAAAGGTAAGGGG - Intronic
1117672540 14:58123241-58123263 CTCAAGCAGGGGATAACAAATGG - Intronic
1118142289 14:63097342-63097364 TTCAGGCAGAGGAAAACAAACGG + Intronic
1118498127 14:66329078-66329100 CTCTGGCTGTGGAAGCCAACTGG - Intergenic
1118560690 14:67078349-67078371 CTGAAGCAGTGGGAGCCAAAGGG - Intronic
1118970057 14:70628613-70628635 CTGAGGCAGGAGAACCCAAGAGG + Intergenic
1121729025 14:96173609-96173631 CTCAGGAAGAGGCATCCAAATGG + Intergenic
1125316866 15:38441315-38441337 CCCAGGCAGTGGGAGCCCAAGGG + Intergenic
1125685357 15:41560192-41560214 CTCAGGGAAGGGAAGGGAAACGG + Intronic
1127827244 15:62715529-62715551 CTGAAGCAGGGGAAGGCTAATGG - Intronic
1128362519 15:66972381-66972403 CTCAAGCAGGGGACAACAAATGG + Intergenic
1128525488 15:68409420-68409442 CTAAGGCAGGAGGAGCCAACAGG - Intronic
1130721707 15:86393307-86393329 ATCAGGCAATGGAAGCCAACTGG + Intronic
1130745809 15:86652826-86652848 CTCTGGCAGGGGAAGTGAAAAGG - Intronic
1131230994 15:90659325-90659347 CTCATGCAGGAGCAGCCAACGGG - Intergenic
1131621795 15:94075746-94075768 ATCCTGCATGGGAAGCCAAATGG + Intergenic
1132842981 16:1987261-1987283 CTCTGGCTGGGGAGGCCCAAAGG - Exonic
1133198880 16:4190260-4190282 GTCAGGCAGGGTAAGCCAGTTGG - Exonic
1133651932 16:7820753-7820775 ATCAGGCAGAGGAAGACAAATGG + Intergenic
1134655217 16:15942963-15942985 GTCTGGCAGGGGAGGCCATATGG + Intergenic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1135209523 16:20512372-20512394 CTCTTGCAGGGGAGGCCAGAGGG + Intergenic
1136061551 16:27730052-27730074 CCCAGGCAGGGGAGGCCCAGGGG + Intronic
1136564952 16:31064247-31064269 CTAAGGCAGAGGAAGCCAGTGGG - Exonic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1138698321 16:58836455-58836477 CTAAGTCAGGGGAAGCCCAAGGG - Intergenic
1139505405 16:67395925-67395947 CTCAGCCAGGGGAAAACAATTGG - Intronic
1140535433 16:75705210-75705232 CCCAGGGAGGGGAAGCCTCAAGG - Intronic
1141970050 16:87475201-87475223 CTTAGGCTGGACAAGCCAAACGG + Intronic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1142842648 17:2645701-2645723 CTGAGGCAGGAGAACCCAAGAGG - Intronic
1142976216 17:3646130-3646152 ATCAGGCAGGGGAAGTGAGATGG + Intronic
1143107111 17:4535378-4535400 CTCAGGGAGGGGAACCAAGATGG + Intronic
1143743338 17:8970952-8970974 CTGAGGAAGGAGAAGACAAAAGG + Intergenic
1143776861 17:9205303-9205325 CTGAGGGCTGGGAAGCCAAAAGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1143990858 17:10960005-10960027 CTCAGGTAGCTGAAGACAAAGGG + Intergenic
1145982155 17:29019318-29019340 TTCAGGAAGTGGAAGCCACAGGG - Intronic
1146067119 17:29644706-29644728 CTGAGGCAGGAGAATCCAGAAGG + Intronic
1146276041 17:31516338-31516360 GTCTGTCAGAGGAAGCCAAACGG - Intronic
1147123311 17:38349174-38349196 CTAAGGCAGGGCAAGCCATGGGG - Intergenic
1147181833 17:38691349-38691371 CTCTTCCAGGGGAAGCCAAGCGG + Intergenic
1147678044 17:42220688-42220710 CTCAGGAAAGGGAGGCCGAAGGG + Intronic
1147688002 17:42298884-42298906 CTCAGGAAAGGGAGGCCGAAGGG - Intronic
1147878690 17:43639848-43639870 CTGAGGCAGGAGAACCCAAGAGG + Intergenic
1148736178 17:49866128-49866150 CTGATGCAGGGGAAGCCACAGGG - Intergenic
1149004743 17:51793868-51793890 CTCAGGCATTGGAAGGCAGATGG - Intronic
1149082791 17:52678281-52678303 CTCAGGCATGTGAAGGCACAGGG - Intergenic
1149213426 17:54328713-54328735 CTTAGGCAGGGGACAACAAATGG - Intergenic
1149423599 17:56533645-56533667 CTCAGGGTGGGGAAGGCACATGG - Intergenic
1151500498 17:74485194-74485216 CTCAGGGAGGCCAAGGCAAAAGG - Intergenic
1152494847 17:80663791-80663813 CTCAAGCAGAGGAAGGCACAAGG - Intronic
1152778845 17:82217640-82217662 CTGAGGCTGGGGAAGCTAAGGGG + Intergenic
1153401652 18:4689150-4689172 CTCAAGCAGGGGACAACAAATGG - Intergenic
1154290546 18:13102463-13102485 CTGAGACAGGGGTAGCCACAAGG - Intronic
1155090393 18:22503763-22503785 TTCAGGCATGGGAAGAGAAAAGG - Intergenic
1155530724 18:26763890-26763912 CGCAGGCAGGGGAATCCATCTGG + Intergenic
1155990963 18:32278950-32278972 CTCAGGCAAGGGAGGCCCAGGGG + Intronic
1156160312 18:34350980-34351002 CTCTGGAAGGGGAAGCTAATGGG + Intergenic
1156590869 18:38486577-38486599 TTCAAGCAGGGGAACCAAAAGGG + Intergenic
1156797751 18:41068839-41068861 TTCAGCCAAGGAAAGCCAAAAGG - Intergenic
1157948076 18:52003633-52003655 CTGAGGGAGGAGAAGCCAGAAGG - Intergenic
1162412594 19:10515361-10515383 CTCAGGCCTGGGAGGCCAAGGGG + Intronic
1162527923 19:11217390-11217412 CTCTGGCAGGGAAAGACAGAGGG + Exonic
1165231668 19:34391117-34391139 CTCAGGCACTGGAAGCCCAAGGG - Intronic
1165860731 19:38907883-38907905 CTCAGGCAGGGGTGGAGAAAAGG + Intronic
1166366123 19:42279377-42279399 CTGAGTCTGGGGAAGCCAAGGGG + Intronic
1166890119 19:45986425-45986447 CTCAGGCAGGGCAGTCCAGAAGG + Intergenic
1167532269 19:50025445-50025467 CCCAGGCAGGCGAAGCCCAGGGG - Exonic
1167732835 19:51271343-51271365 CTAAGGCAGAGGAAGGCTAACGG - Intergenic
1168374954 19:55869126-55869148 TTCAGGAAGGGGAACCCAGATGG + Intronic
925197777 2:1940627-1940649 CTCAGGAAGGTGCAGCCACAGGG - Intronic
925310018 2:2875526-2875548 CATGGGCAGGGGAAGCCAAGGGG - Intergenic
925425234 2:3743968-3743990 CTGAGGCAGGAGAATCTAAATGG + Intronic
926139597 2:10360259-10360281 CCCAGGCAGGGTGAGCCGAAGGG + Intronic
927553274 2:24016786-24016808 CCCAGACAGGGGAACACAAAGGG - Intronic
927673715 2:25089711-25089733 CTCAGGCAGGGGCAGGGAGAGGG + Intronic
927692743 2:25219683-25219705 CTAAGGCAGGGGAAGGCTGAGGG + Intergenic
928100751 2:28436250-28436272 GTCAGGCAGGTGGAGCCAGACGG + Intergenic
928677147 2:33661259-33661281 CTCAAGCAGGGGACAACAAATGG - Intergenic
928681774 2:33710167-33710189 AGCAGGCAGGGGAAGGCTAAAGG - Intergenic
928733759 2:34261804-34261826 CCCTGGTAGGGGAAGACAAAGGG + Intergenic
930034070 2:47074778-47074800 CTCAGGCAGGGGAAGCCAAAAGG - Exonic
930439855 2:51391601-51391623 CTTAGCCAGGGGAAGCCATAAGG + Intergenic
931288828 2:60854777-60854799 CTCAGGCAGGGACAGGCCAAAGG + Intergenic
931429743 2:62198492-62198514 CTCAGACAGGGAAATCTAAAAGG - Intronic
931542470 2:63344629-63344651 CTCAGTCAAGGGATGGCAAATGG - Intronic
932917781 2:75876173-75876195 CTCAAGCAGGGGAAAACAAACGG - Intergenic
933175149 2:79166034-79166056 CTCAAGCAGGGGACAACAAACGG + Intergenic
933182783 2:79245904-79245926 CTCAGTCAGGGAAAGCCTCAAGG + Intronic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
934677781 2:96261865-96261887 CTCAGGCAGGGGCTGAGAAATGG + Intronic
934770334 2:96903647-96903669 ATCAGGAAGAGGAAGCCACAGGG + Intronic
935284194 2:101549353-101549375 CACAGGGAGGGGAAGCCAGGCGG - Intergenic
937242656 2:120472327-120472349 CTGTGGCAGGGGAAGAGAAAAGG - Intergenic
938096157 2:128465530-128465552 ATCAGGCAGAGGAACCCACAGGG - Intergenic
938246349 2:129780489-129780511 CTCCAGCATGGAAAGCCAAACGG - Intergenic
940472323 2:154114909-154114931 CCCAGGCAGCAGAAGCCAAGTGG - Intronic
940802177 2:158145047-158145069 CTCAGGTAGCTGAAGACAAAAGG + Intergenic
941243575 2:163070277-163070299 CTCAAGCAGGGGACAACAAATGG - Intergenic
941408650 2:165124936-165124958 CTGAAGCAGGGGAAGGCAATTGG - Intronic
942068408 2:172293674-172293696 CTCAGGCAGGGGTGGCAAATGGG - Intergenic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942662039 2:178275700-178275722 GTCACTCAGGAGAAGCCAAACGG + Intronic
943133919 2:183888967-183888989 CTCAGGTAGGGGACAACAAACGG - Intergenic
943408832 2:187520372-187520394 CCTAGCCAGGGGAAGCCAAGAGG - Intronic
944012023 2:194984057-194984079 CTCAGGCAGTGGGAGCCTACGGG - Intergenic
946126529 2:217567815-217567837 CTTAGGCAGGTGAAGCCAACTGG + Intronic
946372616 2:219290077-219290099 GTCAGGAAGGGAAAGCCAGAAGG - Exonic
947185421 2:227451034-227451056 CTCAGGCAGAGGAAGCAACCTGG - Intergenic
947576606 2:231280009-231280031 CTCAGGCAGGTGAAACCAGTGGG + Intronic
947828754 2:233124479-233124501 CTCAGACCAGGGAGGCCAAAAGG - Intronic
1168876718 20:1176944-1176966 CCCAGGGAGAGGAAGGCAAATGG + Intronic
1169927219 20:10795501-10795523 CTCAGCCAGAGGAAGCAAACCGG - Intergenic
1171261656 20:23739435-23739457 CTCAAGCAGGGGACAACAAATGG - Intergenic
1171270794 20:23815325-23815347 CTCAAGCAGGGGACAACAAATGG - Intergenic
1173725330 20:45293396-45293418 CTGGGGGAGGGGAAGCCAGACGG - Intergenic
1175229469 20:57464519-57464541 CACAGGCAGGAGAAACCAGAGGG + Intergenic
1175838855 20:62014217-62014239 CACAGGAAGGTGAAGCCACAGGG + Intronic
1176137366 20:63530109-63530131 CTCATGCAGGAGAATCCCAAAGG + Exonic
1176667162 21:9698225-9698247 CGCAGGCAGAGGAAGCTGAAAGG + Intergenic
1177263408 21:18756063-18756085 CTCAAGCAGGGGACAACAAATGG + Intergenic
1178600632 21:33991491-33991513 GTCAGGCAGGGGAAGGCTGATGG + Intergenic
1179535259 21:42047334-42047356 CTTGGGCAGAGGAAGCCAAGTGG - Intergenic
1179624630 21:42641883-42641905 CTGAGGCACGGGAAGGCTAAGGG + Intergenic
1180150913 21:45947324-45947346 CTCATGCACGGCACGCCAAATGG - Intergenic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1180636179 22:17264733-17264755 CGCAGGCCAGGGGAGCCAAATGG - Intergenic
1181627174 22:24129922-24129944 CTGAGGCAGGTGCAGCCCAAAGG + Intronic
1181967813 22:26668850-26668872 CTCTGGGAGGGGCAGCCAGAGGG + Intergenic
1182772971 22:32809164-32809186 CTCAGGCTAGGGAAGCCAAATGG + Intronic
1184179819 22:42813156-42813178 CTCTGCTAGGGGAAGACAAAGGG + Intronic
1184588285 22:45462496-45462518 TTCAGGCAGGGGAACCTAAGGGG - Intergenic
1185023441 22:48394054-48394076 CCCAGAAAGGGGAAGCCAGATGG - Intergenic
949192026 3:1261594-1261616 CTCAGGCAGAGCAACCCAAATGG + Intronic
952922118 3:38292735-38292757 CTCAAGCAGGGGACAACAAATGG + Intronic
952962188 3:38599141-38599163 CTCAGGCTGGGGATGCCACAGGG + Intronic
953090957 3:39725798-39725820 CTAAGGCTGGGGAAGGGAAAAGG - Intergenic
953202696 3:40791494-40791516 GACAGGCAGGTGAAGCCACAAGG + Intergenic
953622768 3:44547398-44547420 CTCAAGCAGGGGACAACAAATGG + Intergenic
954425908 3:50443048-50443070 CTCAGGGAGGGGGAGCAAACAGG - Intronic
954860420 3:53683940-53683962 CTCAAGCAGGGGAAACACAAAGG + Intronic
954980495 3:54741103-54741125 CAGAGGCAGGGGGAGGCAAAGGG + Intronic
955472288 3:59298189-59298211 CTCATGGAGAGGAAACCAAAGGG - Intergenic
955681369 3:61505388-61505410 CACCGGCAGGGGTAGCCAGAGGG + Intergenic
956195640 3:66651264-66651286 TCCAGGCAGGGGAAGCCATGTGG + Intergenic
956842791 3:73155979-73156001 CTCAAGCAGGGGACAACAAATGG + Intergenic
957000175 3:74875708-74875730 CTCAAGCAGGGGACAACAAACGG + Intergenic
957009421 3:74986559-74986581 CTCAGCCAAGGGAAGCCATGAGG - Intergenic
957427930 3:80064029-80064051 CCCTGGCAGTGGAAGACAAAGGG + Intergenic
957793074 3:84963333-84963355 CTCAGGCATGGAAAGGCATAAGG - Intronic
958016141 3:87942109-87942131 CTCAAGCAGGGGACAACAAATGG + Intergenic
958629696 3:96670153-96670175 CTCAAGCAGGGGACAACAAACGG + Intergenic
959942092 3:112090944-112090966 CAAAGCCAGGGGAAGCCACACGG - Intronic
960971105 3:123140877-123140899 CACAGGCATGGGAAGCCAGCTGG - Intronic
961551834 3:127673857-127673879 CTGAGGCGGGGGCAGCCCAAAGG - Intronic
961610285 3:128132032-128132054 CTCAGGCAGGGGATGAGAGAGGG - Intronic
962495555 3:135936008-135936030 CTCAAGCAGGGGACAACAAATGG - Intergenic
962851901 3:139314276-139314298 CTCTGTCAGGGGAAGCCAGCAGG + Intronic
963021412 3:140875863-140875885 CTCAAGCAGGGGACAACAAATGG - Intergenic
963048622 3:141123664-141123686 ACCAGGCAGGGGAAGCAGAAGGG - Intronic
963188062 3:142440389-142440411 CTCAAGCAGGGGACAACAAACGG - Intronic
963201184 3:142587537-142587559 CACAGGGATAGGAAGCCAAATGG - Intergenic
963915876 3:150858450-150858472 CTCAAGCAGGGGACAACAAACGG - Intergenic
963950993 3:151200690-151200712 CTCAGGTAGGGAAAGAGAAAGGG - Intronic
964953534 3:162325467-162325489 CTCAAGCAGGGGACAACAAATGG - Intergenic
966220244 3:177544441-177544463 TCCAGGCAGGGAAAGCCAAATGG + Intergenic
966770545 3:183499936-183499958 CTCAGGGAGGTGAAGTCACATGG - Intronic
967209099 3:187150702-187150724 CCCAGGCAGCAGAAGACAAAGGG + Intronic
968896539 4:3407302-3407324 CTCACGGATGGGAAGCCAACAGG - Intronic
969125682 4:4946109-4946131 CTCAGGGAGGAGGATCCAAAAGG + Intergenic
969707773 4:8821131-8821153 CTCAAGCATGGGCTGCCAAAAGG + Intergenic
970616134 4:17769992-17770014 ATCAGGCAGAGGAAACCAAGAGG + Intronic
971578630 4:28306548-28306570 CTCAAGCAGGGGAATACAAATGG - Intergenic
973960624 4:56106256-56106278 CTCATGCAGGGGAAGTCTAAAGG - Intergenic
975313702 4:72929419-72929441 CTCAAGCAGGGGACAACAAATGG + Intergenic
975680230 4:76868445-76868467 CCCTGGTAGGGGAAGACAAAGGG + Intergenic
976315673 4:83656375-83656397 CTCAGGCATGAAAAGCAAAAGGG + Intergenic
976370747 4:84285848-84285870 CTGAGCCAAGGGAAGCCACAAGG + Intergenic
976474499 4:85468303-85468325 CTCAGGCTGGGGAGGGCAAATGG - Intergenic
977571542 4:98634316-98634338 CTTAGGTAGGGCAAGGCAAAAGG - Intronic
978512837 4:109540056-109540078 CTCTGGCAAGAGATGCCAAAAGG + Exonic
980444320 4:132886246-132886268 CTCAAGCAGGGGACAACAAACGG - Intergenic
981134039 4:141190054-141190076 CTTAGCCAAGGGAAGCCATAAGG - Intronic
984723852 4:183001504-183001526 CTCAAGCAGGGGACAACAAACGG - Intergenic
985407847 4:189654112-189654134 CGCAGGCAGAGGAAGCTGAAAGG - Intergenic
986546898 5:8907713-8907735 CCCATGCAGGGAAAGCCAAGTGG - Intergenic
986840212 5:11687929-11687951 CTCAGGCAGAGAAAACCATAAGG + Intronic
986933454 5:12854916-12854938 CTCAGGCAGGGGACAACAAATGG - Intergenic
987008781 5:13738704-13738726 CACAGGAAGAGGAAGCCCAAAGG + Intronic
987750611 5:22034131-22034153 CTGAGGCAGGAGAATCCAGAAGG - Intronic
988357948 5:30201138-30201160 CTCAAGCAGGGGACAACAAATGG - Intergenic
989650888 5:43688663-43688685 CTCAGGAATGGAAAACCAAATGG - Intronic
994568350 5:101482840-101482862 CCCAGGTAGTGGAAGACAAAGGG - Intergenic
995583271 5:113622272-113622294 CTCAAGCAGGGGACAACAAATGG + Intergenic
997981215 5:138468284-138468306 TTCAGGCAGCTGAAGTCAAAGGG - Exonic
998390259 5:141782967-141782989 CACAGGCTGGGGAAGTCAAAGGG - Intergenic
998915215 5:147004676-147004698 CTCAAGCAGGGGACAACAAATGG - Intronic
999171557 5:149599370-149599392 CTCAGGCAGGGGAACCCAAAAGG + Intronic
999718412 5:154380526-154380548 CACAGGCAGGGGATGCCATGCGG + Exonic
1000379254 5:160614336-160614358 CCCAGCTAGGGGAAGCCAACAGG + Intronic
1001314354 5:170632006-170632028 CACAGACAGGGGGAGCTAAAGGG + Intronic
1001845529 5:174917892-174917914 ATCAGGATGGTGAAGCCAAAAGG - Intergenic
1004027901 6:11837028-11837050 CCCATGGAGGGCAAGCCAAAGGG + Intergenic
1004060704 6:12194859-12194881 ATGAGGTAGAGGAAGCCAAAGGG + Intergenic
1006011407 6:31045687-31045709 CTGAGGCTGGGGAGGCCGAATGG + Intergenic
1006096972 6:31662183-31662205 CCCAGGAAGGGGAAGTCAAAGGG + Exonic
1006457756 6:34141783-34141805 CTCAGGCAAGGCAAGCCAGGTGG + Intronic
1008328603 6:50217880-50217902 CCTGGGCAGGGGAAGCAAAAGGG + Intergenic
1008650657 6:53558020-53558042 CTAAGACAGGGGAAAACAAAAGG + Intronic
1008928827 6:56915985-56916007 CTGAGGCAGGCTAAGCCATAAGG + Intronic
1009620595 6:66070734-66070756 CTCAGGCAGTCGAAGCAAATGGG + Intergenic
1010075096 6:71789088-71789110 CTCAAGCAGGGGACAACAAATGG - Intergenic
1010918888 6:81656031-81656053 CTCAGGTTTGTGAAGCCAAAAGG + Intronic
1013007367 6:106086311-106086333 AGCAGGGAGGGGAAGCCAGACGG + Exonic
1013022348 6:106232452-106232474 CTCAAGCAGGGGACAACAAACGG - Intronic
1014127677 6:117795243-117795265 CTCTGAGAGGGGAAGCCATAGGG + Intergenic
1014139269 6:117921571-117921593 CTAAGGAAGGTGAATCCAAAAGG - Intronic
1015367325 6:132411008-132411030 CCCAGAAAGAGGAAGCCAAATGG + Intergenic
1015784706 6:136910377-136910399 CTCTGGCAGAGCAAGGCAAAGGG + Intronic
1016444605 6:144119206-144119228 CTCAAGCAGGGGACAACAAACGG + Intergenic
1016542101 6:145177861-145177883 CTTAGGCAAGGGAAGCCATGAGG + Intergenic
1019475589 7:1242657-1242679 CTCAGGGAGGGGAAGCGAGGAGG - Intergenic
1019809219 7:3152319-3152341 CTAAGGCTGGGGAACTCAAAGGG + Intronic
1020823912 7:13003192-13003214 CTTAGCCAAGGGAAGCCATAAGG - Intergenic
1021202473 7:17741805-17741827 CTCAGGCAAGGGAAGGAACAAGG + Intergenic
1021777576 7:24068588-24068610 CTCAGGCAGGGGTTGCCCAATGG - Intergenic
1022086400 7:27072242-27072264 CACAGGCATGGGGATCCAAAAGG - Intergenic
1022529531 7:31058182-31058204 TTCAGCCAGGGGAAGCAGAAGGG + Intronic
1022625636 7:32033106-32033128 CCCAGGCAGGGCAAGGCAGAAGG + Intronic
1022848758 7:34238061-34238083 TGCAGGCAGGCGAAGCCACATGG - Intergenic
1024217993 7:47264054-47264076 CTCAAACAGGGAAAGCCAGATGG - Intergenic
1024613326 7:51085465-51085487 CACAGGCAGGGGAGGCCATGAGG + Intronic
1024970711 7:55067138-55067160 CTCACGCAGGTGCAGCCCAATGG - Intronic
1025033605 7:55576624-55576646 CTCAGCCAAGGGAATCCCAAAGG - Intergenic
1026031932 7:66801791-66801813 GTCATGCAGGTGGAGCCAAATGG - Intronic
1026043033 7:66884858-66884880 CACAGGCTGGAGAATCCAAAAGG - Intergenic
1028182939 7:87747558-87747580 CCCTGGCAGCGGAAGACAAAGGG - Intronic
1028588472 7:92473519-92473541 CTCAAGCAGGGGACAACAAACGG + Intronic
1031264668 7:119567941-119567963 CTCAAGCAGGGGACAACAAATGG - Intergenic
1032840213 7:135707550-135707572 TACAGGCAGGGGAATCCAAATGG + Intronic
1033557896 7:142504973-142504995 CTCATGCAGGAGAAACCAAATGG - Intergenic
1033794499 7:144831585-144831607 CTGAGGCAGGAGAAGCCAGGAGG + Intronic
1035370304 7:158375655-158375677 GGCAGGCATGGGAGGCCAAAAGG - Intronic
1037903356 8:22701140-22701162 CGCAGTCAGGGGAAGCAAAGAGG + Intergenic
1040971325 8:53140044-53140066 CTCAAGCAGGGGACAACAAATGG + Intergenic
1040978924 8:53225134-53225156 CTTAGGCATGGGAAGTAAAAAGG - Intergenic
1041862937 8:62534786-62534808 GGCAGGCAGGGGCAGCCATATGG - Intronic
1042488343 8:69371155-69371177 CTCTGGCAGTCTAAGCCAAAAGG - Intergenic
1043398055 8:79857815-79857837 CTGAGGGAGGAGAAGCAAAAAGG - Intergenic
1043478822 8:80631969-80631991 CTCAGGCAGATGAGGGCAAAGGG + Exonic
1043490079 8:80740281-80740303 CTCAAGCAGGGGACAACAAATGG - Intronic
1045110234 8:98933583-98933605 CTCAGGCATGGGAAGCCCTTGGG + Intronic
1045503226 8:102759041-102759063 CTCAAGGAGGGGAGGCCAAAGGG + Intergenic
1048290165 8:133175113-133175135 CTCAGCCAGGGGTAGCCATGGGG - Intergenic
1048958503 8:139556473-139556495 TTCAGGCAGGGGTAGGCAAGAGG + Intergenic
1049082108 8:140451475-140451497 CAGAGGCAGGGGAAGCCCCAAGG + Intronic
1050433705 9:5587493-5587515 CTCAAGCAGCGGAAGGCAGATGG + Intergenic
1051452037 9:17207565-17207587 CCCAGCCAAGGGAAGCCACAAGG - Intronic
1054947334 9:70810028-70810050 CTCAGGCATAGGATGACAAAGGG + Intronic
1055208448 9:73761830-73761852 CTCAGGCACGGGCAGACACAGGG + Intergenic
1057048381 9:91903317-91903339 CTTGGGCAGGGGAAGCCAGCGGG - Intronic
1057254096 9:93529394-93529416 CGAAGGCAAGGGAAGCCAGATGG + Exonic
1057392465 9:94651203-94651225 GCCAGTCAGGAGAAGCCAAAGGG - Intergenic
1058429633 9:104906680-104906702 CTCAGGTAACTGAAGCCAAAGGG + Intronic
1059079505 9:111233552-111233574 CTCCTGCAGGGGAGGTCAAAGGG - Intergenic
1060724269 9:125996912-125996934 CTCGGGCAGGGGTAGGCAGAAGG - Intergenic
1061055670 9:128221567-128221589 CTGAGGCAGGGGTGGCCAGAGGG - Intronic
1061807714 9:133145664-133145686 CTCAGAGAGGGGAAGCCATCTGG + Intronic
1185752759 X:2627342-2627364 CTCAGGGAGGTGGACCCAAATGG - Intergenic
1186254138 X:7701251-7701273 CTCAAGCAGGGGACAACAAACGG + Intergenic
1186770122 X:12810125-12810147 CTGACGCAGGGGGAGCCAAAAGG + Exonic
1187831371 X:23385375-23385397 CTCAGTCAGAGGAATACAAAGGG + Intronic
1190541605 X:51483159-51483181 CTCAAGCAGGGGACAACAAATGG - Intergenic
1191166981 X:57401789-57401811 CTCAAGCAGGGGACAACAAATGG + Intronic
1191168600 X:57418456-57418478 CTTAGCCAAGGGAAGCCATAAGG - Intronic
1192304379 X:69943940-69943962 CTGAGGCAGTGGTAGCCACAGGG - Intronic
1192482620 X:71498674-71498696 CTCAAGCAGGGGACAACAAATGG + Intronic
1192707351 X:73540816-73540838 CCCAGGCAAGGGAAGCCATGAGG + Intergenic
1192859250 X:75048318-75048340 CCCAGGCAGACAAAGCCAAAAGG - Intergenic
1192934016 X:75839475-75839497 CTCAGCCAAGGGAAGCCTTAAGG - Intergenic
1193171864 X:78346618-78346640 CTCAAGCAGGGGACAACAAATGG + Intergenic
1193306812 X:79960214-79960236 CTCAAGCAGGGGACAACAAATGG - Intergenic
1193317189 X:80077535-80077557 CCCAGGGAGGAGAAGCCAGATGG + Intergenic
1194206693 X:91019115-91019137 CTCAGGCAGTGGAAGTCAGAGGG + Intergenic
1195086283 X:101417470-101417492 CTGGAGCAGGGGAAGGCAAAGGG - Intergenic
1196127220 X:112113261-112113283 CTCAAGCAGGGGACAACAAATGG + Intergenic
1196419236 X:115506086-115506108 CTCAAGCAGGGGACAACAAATGG + Intergenic
1197669060 X:129255804-129255826 CTCTGGCAGCTGAAGACAAAGGG - Intergenic
1198526750 X:137509186-137509208 CTCTGGTAGCGGAAGACAAAGGG - Intergenic
1200552441 Y:4593904-4593926 CTCAGGCAGTGGAAGTCAGAGGG + Intergenic