ID: 930035720

View in Genome Browser
Species Human (GRCh38)
Location 2:47083941-47083963
Sequence CACTCCTACATGATTTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930035720_930035727 4 Left 930035720 2:47083941-47083963 CCCCAGAAAATCATGTAGGAGTG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 930035727 2:47083968-47083990 TGGCCGGCACCCCAGGGATCAGG 0: 1
1: 1
2: 2
3: 18
4: 164
930035720_930035732 25 Left 930035720 2:47083941-47083963 CCCCAGAAAATCATGTAGGAGTG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 930035732 2:47083989-47084011 GGAAGCTGAGATCAGCGAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 280
930035720_930035725 -3 Left 930035720 2:47083941-47083963 CCCCAGAAAATCATGTAGGAGTG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 930035725 2:47083961-47083983 GTGCAGTTGGCCGGCACCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 101
930035720_930035726 -2 Left 930035720 2:47083941-47083963 CCCCAGAAAATCATGTAGGAGTG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 930035726 2:47083962-47083984 TGCAGTTGGCCGGCACCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 106
930035720_930035733 28 Left 930035720 2:47083941-47083963 CCCCAGAAAATCATGTAGGAGTG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 930035733 2:47083992-47084014 AGCTGAGATCAGCGAGAAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930035720 Original CRISPR CACTCCTACATGATTTTCTG GGG (reversed) Intronic
900944252 1:5820888-5820910 CACTGCCACATGGTTTGCTGGGG - Intergenic
902129347 1:14245219-14245241 GCCTCCTACATGTTTTCCTGAGG - Intergenic
903979944 1:27178536-27178558 CCCTGTTACATAATTTTCTGGGG - Intergenic
905613854 1:39379873-39379895 CTTGCCTACAGGATTTTCTGTGG - Intronic
907903387 1:58762213-58762235 CACTCCTGCATGTATTTGTGAGG - Intergenic
910261438 1:85297185-85297207 TGCTCCTACATGTTTCTCTGTGG - Intergenic
912300244 1:108508665-108508687 CGTTCCTACATGATTTCCGGTGG + Intergenic
914716774 1:150260394-150260416 CACTCCTACACGATTTACTGAGG - Intronic
916670176 1:167010363-167010385 CCCTCCTTCATGTTTTTTTGGGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918478296 1:184949855-184949877 CAGTACTGCATAATTTTCTGTGG - Intronic
918489719 1:185068482-185068504 CACTGCTTCATGCTCTTCTGTGG - Intronic
919110776 1:193216552-193216574 CCCTCCTCCTTGATTTTTTGGGG - Intronic
921883777 1:220282746-220282768 CACTTCAACATGAGTTTCAGAGG + Intergenic
1063908644 10:10806556-10806578 TGCTCCTACATGATTTATTGTGG + Intergenic
1064139898 10:12781489-12781511 CACTCCTCCATGATTGGCTTTGG + Intronic
1065493133 10:26302858-26302880 TACTCCTTCATGAAATTCTGCGG - Exonic
1075192303 10:120320835-120320857 CACTCCTTCATCTTTTTCTTTGG + Intergenic
1078923005 11:15848451-15848473 CACTCCTCCATGCTATTATGTGG - Intergenic
1079138373 11:17789546-17789568 AACTCATTCATGTTTTTCTGTGG + Intronic
1080393244 11:31867145-31867167 CTCTGCTTCATGATTATCTGGGG + Intronic
1087630412 11:100644190-100644212 CATTCATACTTGCTTTTCTGAGG + Intergenic
1087832814 11:102838061-102838083 CACTACTATATGATTTTCAAGGG - Intronic
1088071758 11:105795408-105795430 CTCTCCTACAAGTTTTTCAGGGG - Intronic
1089865090 11:121624604-121624626 CATTCCTACATATTGTTCTGGGG + Intronic
1093130819 12:15390090-15390112 CAATCTCACAGGATTTTCTGGGG + Intronic
1093514953 12:19974655-19974677 CATTCCCAGATGATATTCTGGGG - Intergenic
1095775330 12:46003905-46003927 CACTCCTAAGTGATTGCCTGTGG + Intergenic
1097154271 12:57001502-57001524 CACTCTTACTTGGTTTTCTAAGG - Exonic
1099358944 12:81673846-81673868 CACTCATTCATGATTTTCAAGGG - Intronic
1100067106 12:90662541-90662563 CACTACAACAGGATTTTCTCTGG - Intergenic
1101257335 12:102991311-102991333 AACTTCAACATAATTTTCTGCGG + Intergenic
1103554948 12:121760559-121760581 AACTCGTACATGACTTTCCGGGG - Intronic
1103640138 12:122344330-122344352 CATTTACACATGATTTTCTGGGG + Intronic
1103999426 12:124850936-124850958 TACTCCTACCTGAGTCTCTGTGG + Intronic
1104281070 12:127378199-127378221 CAGGCATACAAGATTTTCTGGGG + Intergenic
1106902608 13:34369740-34369762 CCCTTCTCCATGATTTTCTCTGG - Intergenic
1108970062 13:56362869-56362891 CAATCCTACATGATATTTGGTGG + Intergenic
1109632814 13:65075007-65075029 CACTCTTAGAAGATTTTCTAAGG - Intergenic
1110522535 13:76497703-76497725 CACAACTACAAGATTTTCTAAGG + Intergenic
1110614042 13:77521445-77521467 CACTCTTACATGATTCACTCAGG + Intergenic
1111587288 13:90298415-90298437 CTCTCCTGCATAATTTCCTGAGG + Intergenic
1112420729 13:99245853-99245875 CACTAATACATGGTTTTTTGGGG - Intronic
1112910509 13:104477466-104477488 CACTCAAATATGAGTTTCTGTGG + Intergenic
1112948934 13:104965989-104966011 CACTCTTACATGATCTACTTAGG - Intergenic
1113380777 13:109803773-109803795 CATTCCTACATGATTTATTGAGG - Intergenic
1116650604 14:47586809-47586831 CACTTATAGATGATTTTGTGTGG - Intronic
1118946080 14:70388606-70388628 TACTCCTCCATGATTTTCTCAGG - Exonic
1119467337 14:74869121-74869143 CACTCCTACATATTTCTTTGGGG + Intronic
1119830375 14:77696906-77696928 GACTCCTTCATGAGTTGCTGTGG + Intronic
1119911154 14:78350427-78350449 AACTCCTACATGCTTTTGTTGGG - Intronic
1121206105 14:92169003-92169025 CCTTCCTACCTCATTTTCTGAGG + Exonic
1122135423 14:99630079-99630101 GACTCCCACATGGTTATCTGAGG - Intergenic
1128375047 15:67068079-67068101 CACTTTCACATGGTTTTCTGAGG + Intronic
1131295119 15:91141156-91141178 CATTCCCACAGGATTTTCTTCGG + Intronic
1131539169 15:93261611-93261633 GACTCCTACAGGATTTCATGTGG - Intergenic
1131714072 15:95089642-95089664 CACTCTTTCAGGATTTTGTGAGG - Intergenic
1133277497 16:4647619-4647641 CACTGCAAGATCATTTTCTGAGG - Intronic
1139579450 16:67863773-67863795 CAGACCCACATGTTTTTCTGTGG - Intronic
1142780466 17:2177482-2177504 CACTCCTTCATATTTTACTGGGG + Intronic
1144009196 17:11129706-11129728 TACTCCTACAAGTTTTTGTGTGG - Intergenic
1144199615 17:12928448-12928470 CACTTACTCATGATTTTCTGTGG - Intronic
1145002653 17:19316060-19316082 CAGTCCTTCATGACTTTCTGTGG + Intronic
1146511523 17:33453371-33453393 CTCTCCTACATATTTTTCTAAGG + Intronic
1151537180 17:74745559-74745581 AACTCCTACTTGAGTTCCTGCGG + Exonic
1153109217 18:1563874-1563896 CACACATACATGTTTTTCTTTGG + Intergenic
1153612985 18:6906677-6906699 TTCTCCTACATTATTTTCTAAGG - Intronic
1156108391 18:33693063-33693085 AACCCCAACATGATTTTCTTCGG - Intronic
1156368145 18:36448522-36448544 CTCTCCCACATGACTCTCTGGGG + Intronic
1157850262 18:51042173-51042195 TCCTCCTACATGAATTTCTGGGG - Intronic
1158886571 18:61833559-61833581 CACACAAACATGATTTCCTGAGG + Intronic
1159196996 18:65129244-65129266 CACTTCTACATAAATTTTTGAGG - Intergenic
1159403769 18:67973518-67973540 CACTTCTGCATGACTTTCGGCGG + Intergenic
1167908288 19:52680443-52680465 GACTCCTCCATGATGTTTTGTGG - Intronic
925300471 2:2808023-2808045 CATTCCTCCGGGATTTTCTGGGG - Intergenic
927358063 2:22196886-22196908 CACTCCAAAAGGATTTTCTTAGG - Intergenic
928233365 2:29519405-29519427 CAATCCTACATGACTGTTTGTGG - Intronic
930035720 2:47083941-47083963 CACTCCTACATGATTTTCTGGGG - Intronic
938109736 2:128555815-128555837 AACTGCTGCCTGATTTTCTGAGG + Intergenic
940283162 2:152008069-152008091 CAATTCTACATAATTTTCTGAGG + Intronic
940640208 2:156336563-156336585 CTTTCCTAAATGTTTTTCTGTGG - Intronic
941512537 2:166431110-166431132 CACTCCAACATGCTGTGCTGTGG + Intronic
942706245 2:178776104-178776126 CACACCTTCAGGATTTTCCGCGG + Exonic
943153179 2:184139064-184139086 CACTCCTAAAAGATCTTCAGAGG - Intergenic
945986543 2:216358998-216359020 CACTCCTGAATTATGTTCTGAGG - Intronic
1170364357 20:15583438-15583460 CAATCCTGCTTCATTTTCTGCGG + Intronic
1173699569 20:45056486-45056508 CACTACTACTTTATTTTCAGTGG + Intronic
1173736804 20:45367605-45367627 CACACCTACATTTCTTTCTGTGG - Exonic
1173761894 20:45569088-45569110 CAATCCTGCTTGATTTTCAGGGG + Intronic
1177184257 21:17775963-17775985 CAGTCCTTCATGACTTCCTGTGG + Intergenic
1177266429 21:18790633-18790655 CACTCATGCATTTTTTTCTGAGG + Intergenic
1177605178 21:23368540-23368562 CACTACTATAAAATTTTCTGAGG + Intergenic
1177682805 21:24395359-24395381 CATTGCTACAGGATTTTTTGGGG - Intergenic
1179099141 21:38341501-38341523 CAGTCCTACGTGATCTTCTGAGG - Intergenic
1182009453 22:26988278-26988300 CACTCATACATGATTCAGTGAGG + Intergenic
1182155988 22:28073436-28073458 CACTCCTCCATCTTCTTCTGTGG - Intronic
1182227896 22:28813965-28813987 CCCTCCTACATGAAATTCTAGGG + Intergenic
950978070 3:17271345-17271367 TACTCCTAGATACTTTTCTGTGG + Intronic
951163891 3:19461508-19461530 CAGTCACACAGGATTTTCTGTGG + Intronic
951857388 3:27213090-27213112 CCCTGTTACAGGATTTTCTGGGG - Intronic
952444455 3:33367046-33367068 TGCTCCTACATGTTTTTTTGGGG + Intronic
952509529 3:34039206-34039228 CACTCCAACATTATTGTCTGAGG + Intergenic
954700400 3:52447803-52447825 CCCTCCTACAGTATCTTCTGGGG + Intergenic
955181820 3:56679254-56679276 CACTCCTAAAGTATTGTCTGTGG - Intronic
956556742 3:70532124-70532146 CACACCTGCATGTTTTTCTCAGG - Intergenic
959238033 3:103749845-103749867 CAGTCCTAGATTATTTTCTCAGG + Intergenic
959295767 3:104531857-104531879 CAATTCTACAAGATTTTATGGGG - Intergenic
962438983 3:135394621-135394643 CACTCCTACAGGCTGCTCTGTGG + Intergenic
963341114 3:144034900-144034922 CTCTCCTACATGGAGTTCTGAGG + Intronic
967854525 3:194106713-194106735 CCCTCCTACTTCATATTCTGGGG - Intergenic
969326219 4:6445821-6445843 CACACCAACATGATGTTCTAAGG + Intronic
970526922 4:16942169-16942191 GACTCCTACATGCTTTTCCAGGG + Intergenic
974818791 4:67039898-67039920 AATTTCAACATGATTTTCTGGGG - Intergenic
976195410 4:82527360-82527382 CACACGTACTTGTTTTTCTGTGG + Intronic
976890350 4:90039373-90039395 CACCCCTAGATGATTCTGTGGGG - Intergenic
976927212 4:90514336-90514358 TAATCATACATCATTTTCTGTGG + Intronic
977791211 4:101105856-101105878 CACTCCAACATGATAGTCTTGGG + Intronic
978649118 4:110979226-110979248 CACTCTTATATGGTTTTTTGAGG + Intergenic
979920857 4:126494131-126494153 CACTCCTTCTTGAGTTTCAGTGG - Intergenic
979964035 4:127055805-127055827 GACCCCTACAGGATCTTCTGTGG - Intergenic
980291752 4:130853789-130853811 CACTTGTTCATAATTTTCTGAGG - Intergenic
982550692 4:156795321-156795343 AAATCCTCCATGATTTTATGAGG - Intronic
983210412 4:164952713-164952735 CACTCCTCCATTTTTTTCTTTGG + Intergenic
984194677 4:176644496-176644518 CAATACTAAATGACTTTCTGAGG - Intergenic
984523582 4:180829633-180829655 CATTTCTACATCATTATCTGAGG - Intergenic
985625001 5:980980-981002 GACTCCTAAATTATTGTCTGAGG + Intronic
986862510 5:11943863-11943885 CACTTCAACATGAGTTTCCGAGG - Intergenic
988573970 5:32401063-32401085 CACTTCTACATCAGTTTCTGAGG - Intronic
990010026 5:50986541-50986563 AATTCTTACATAATTTTCTGTGG + Intergenic
990402770 5:55456012-55456034 CATTCCTCTAAGATTTTCTGGGG - Intronic
992255590 5:74917842-74917864 GATTCCAGCATGATTTTCTGGGG + Intergenic
994493283 5:100476047-100476069 CACTCCTACAGGATTATTTGAGG + Intergenic
994533165 5:100992608-100992630 CACTCCTAGATGCTATTGTGGGG - Intergenic
994597559 5:101859694-101859716 CACTCCTACCAGATCTTCAGAGG + Intergenic
994813196 5:104549173-104549195 CTCTCCTGCATGAGTTTCTTTGG + Intergenic
995001520 5:107136708-107136730 CCCTCCTGCATGACTTTGTGGGG - Intergenic
996645340 5:125808055-125808077 AACTCCTATATTATTCTCTGTGG - Intergenic
998783671 5:145685893-145685915 ATCTCCTCCAAGATTTTCTGAGG + Intronic
999149649 5:149418254-149418276 CACACCTACATGATGTGGTGGGG - Intergenic
1001962004 5:175885073-175885095 CACTCAGACATGATGCTCTGTGG - Intergenic
1005203277 6:23371492-23371514 CACTCATACATGATTTTTCAAGG - Intergenic
1006246835 6:32744648-32744670 CGTTCCTACATGCTTTTCTTTGG + Intronic
1007350553 6:41270344-41270366 CACTCCTACATGCTTGACAGAGG - Intronic
1009496019 6:64347617-64347639 CACTCCAACATGATTTCCACTGG + Intronic
1010576972 6:77543990-77544012 CATTCCTACAAGTCTTTCTGGGG + Intergenic
1011828681 6:91341843-91341865 CTCTCCTAAGTGATTTTGTGCGG + Intergenic
1011864320 6:91804373-91804395 CACTCCCACATCCTTTTCTCTGG + Intergenic
1015099535 6:129459748-129459770 TGCTCCTACATAATTTTCTTTGG - Intronic
1015625468 6:135177351-135177373 CATTACTAAAAGATTTTCTGGGG + Intergenic
1015678707 6:135780741-135780763 CACTCCTAAAAGATCTTCAGAGG + Intergenic
1016275114 6:142340877-142340899 CCCTGTTACATCATTTTCTGTGG + Intronic
1017435540 6:154412311-154412333 CACTCATGAAGGATTTTCTGAGG - Intronic
1018497775 6:164367735-164367757 CATTTCTACAAAATTTTCTGTGG - Intergenic
1018938936 6:168295152-168295174 CACCCCGACAGGATCTTCTGAGG + Intronic
1019967840 7:4514563-4514585 CACTCCTACCAGCTGTTCTGGGG - Intergenic
1022712721 7:32866659-32866681 CAATCCGACATGATTTTGGGTGG + Intergenic
1023097477 7:36675930-36675952 CACTGCTTCATGATTTTATTAGG + Intronic
1023540949 7:41265232-41265254 AACTCCTCCATGTTTTTGTGTGG + Intergenic
1026385678 7:69845387-69845409 CACTCATGCTTGATTTCCTGAGG + Intronic
1028530352 7:91831781-91831803 CACTCCTGGATGATGTTGTGGGG - Intronic
1029544059 7:101201170-101201192 CACTCCAACATCAATTCCTGAGG - Intergenic
1031830572 7:126620465-126620487 CACTCCAACATGGTTTTGTAGGG + Intronic
1035040794 7:155925710-155925732 CAATCCAACATGGTTTTCAGTGG - Intergenic
1035365598 7:158348080-158348102 CCCTCCTACATGCTTTTCTCTGG + Intronic
1038827701 8:31022908-31022930 TACTCCTACATCATTTTCTATGG + Intronic
1038958126 8:32489269-32489291 AACTGGTACATGACTTTCTGGGG - Intronic
1042006080 8:64182056-64182078 CACTCCTAACTGATCTTCAGGGG + Intergenic
1043932989 8:86111765-86111787 CACTCTTACATAATATTCTAAGG + Intronic
1045045241 8:98268655-98268677 CATTCCTACTTTATTTTGTGGGG - Intronic
1045331723 8:101161229-101161251 CACTCTTATATGAGTTGCTGTGG + Intergenic
1046651455 8:116840621-116840643 TTCTCCTACATGATTTTCCAGGG + Intronic
1048240443 8:132736385-132736407 CACCCACTCATGATTTTCTGAGG - Intronic
1051361727 9:16286864-16286886 CATTCATACCTCATTTTCTGGGG + Intergenic
1054743918 9:68835198-68835220 CACTCCTCTATGATTTTGAGAGG - Intronic
1055264416 9:74478437-74478459 CAATCCTAAATAAATTTCTGTGG + Intergenic
1056088812 9:83184482-83184504 CACCCCTACGTGGTTTTATGGGG + Intergenic
1059055649 9:110976616-110976638 CATTGCTTCATGGTTTTCTGTGG - Intronic
1059569130 9:115415553-115415575 CACTCCTACAAGCTGTTCTTTGG - Intergenic
1061403712 9:130382430-130382452 CAGTCCTGCATGATTCTTTGAGG - Intronic
1186576343 X:10770179-10770201 CACTGCTACATGAATTAATGTGG + Intronic
1189024836 X:37382377-37382399 CACTGCTACATTATTTCCTTGGG - Intronic
1191729238 X:64315419-64315441 CACTCCTAGAAGATCTTCAGAGG - Intronic
1194135639 X:90137725-90137747 CACTGTTACAGAATTTTCTGGGG - Intergenic
1194345976 X:92766282-92766304 CAATCCTGCATGAACTTCTGTGG + Intergenic
1194786939 X:98097363-98097385 CAGTCCTCCATTATTTTCTAGGG + Intergenic
1195270016 X:103220231-103220253 CACTCCTAGTAGATCTTCTGAGG + Intergenic
1195667859 X:107446940-107446962 CCCAGCTACATGATTTTCTGGGG + Intergenic
1196398688 X:115291506-115291528 CACTGCTCCATCAATTTCTGAGG - Intronic
1197034009 X:121853474-121853496 CACTCCTAGAAGATTTTCAGAGG + Intergenic
1200310686 X:155073858-155073880 CACTCCTACACCATCTTTTGTGG + Intronic
1200481405 Y:3707806-3707828 CACTGTTACAGAATTTTCTGGGG - Intergenic
1200654321 Y:5882931-5882953 CAATCCTGCATGAACTTCTGTGG + Intergenic
1201395012 Y:13538895-13538917 CACTCCTAAAAGATCTTCAGAGG + Intergenic
1202263023 Y:22989553-22989575 CACCTGTACATGATTTTCTTTGG + Intronic
1202416013 Y:24623294-24623316 CACCTGTACATGATTTTCTTTGG + Intronic
1202454774 Y:25046792-25046814 CACCTGTACATGATTTTCTTTGG - Intronic