ID: 930037906

View in Genome Browser
Species Human (GRCh38)
Location 2:47099345-47099367
Sequence TCACACCTGGGGCAGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 396}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930037906_930037910 1 Left 930037906 2:47099345-47099367 CCAGGCTGCTGCCCCAGGTGTGA 0: 1
1: 0
2: 3
3: 42
4: 396
Right 930037910 2:47099369-47099391 AGCTGCCCTGACAACGCAAATGG 0: 1
1: 0
2: 1
3: 4
4: 89
930037906_930037915 29 Left 930037906 2:47099345-47099367 CCAGGCTGCTGCCCCAGGTGTGA 0: 1
1: 0
2: 3
3: 42
4: 396
Right 930037915 2:47099397-47099419 GCCTCAGCACCGGCAGGAGCAGG 0: 1
1: 0
2: 3
3: 79
4: 1323
930037906_930037913 19 Left 930037906 2:47099345-47099367 CCAGGCTGCTGCCCCAGGTGTGA 0: 1
1: 0
2: 3
3: 42
4: 396
Right 930037913 2:47099387-47099409 AATGGCTAAAGCCTCAGCACCGG 0: 1
1: 0
2: 2
3: 11
4: 125
930037906_930037914 23 Left 930037906 2:47099345-47099367 CCAGGCTGCTGCCCCAGGTGTGA 0: 1
1: 0
2: 3
3: 42
4: 396
Right 930037914 2:47099391-47099413 GCTAAAGCCTCAGCACCGGCAGG 0: 1
1: 0
2: 0
3: 35
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930037906 Original CRISPR TCACACCTGGGGCAGCAGCC TGG (reversed) Intronic
900115799 1:1027375-1027397 TCACACCTGCAGCACCAGCCCGG - Intronic
900127164 1:1073727-1073749 TCACTTCTGGGGCAGCCTCCTGG - Intronic
900152264 1:1183799-1183821 TCACACCTGGGACAGAGGCGGGG + Intronic
900184268 1:1325602-1325624 TCACATCTGGGGCCTCCGCCTGG + Intronic
900440649 1:2653438-2653460 GCACACCTGGGGGTGCAGGCTGG - Intronic
900543656 1:3216654-3216676 CCAAACCTGGGGCAGGAGTCAGG + Intronic
900959989 1:5912839-5912861 TCACCCCTGCGGCAGAGGCCTGG + Intronic
901220151 1:7579098-7579120 TGAGACCTGGGGCAACAGACGGG + Intronic
901323359 1:8352330-8352352 CCCCACCTGGGGTAACAGCCAGG + Intergenic
901628756 1:10638347-10638369 CCAGGCCTGGGGGAGCAGCCGGG + Exonic
901871169 1:12140156-12140178 CCACACCTGAGCCAGCTGCCTGG - Intronic
905216879 1:36414967-36414989 TCCCACCTGGGGCAGGGCCCAGG + Intergenic
906294806 1:44643075-44643097 ACACACTTGAGGCAGCAGGCAGG - Intronic
906510735 1:46409245-46409267 GCAGACCTGGGGGAGCAGCAGGG + Intronic
906570196 1:46831259-46831281 TCACACTTGGAGCTGCAGACTGG + Intergenic
906654773 1:47539991-47540013 CCACACATGGTGCAGCAACCAGG + Intergenic
907258559 1:53198263-53198285 CCACACATGGGGAAGAAGCCTGG - Intronic
907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG + Intronic
907831696 1:58070467-58070489 AGACACCTGGGGCAGGAGCGGGG + Intronic
908539745 1:65111368-65111390 TCCCACCTGTGACAGCAGACAGG - Intergenic
911051792 1:93677577-93677599 TCTGACCTGGGGCAGCAGCTGGG + Intronic
911144931 1:94542252-94542274 GCCCACCTGGGGCAGAAGCTCGG + Intergenic
912002490 1:104852354-104852376 TAACACCTTGGACAGCAGCAAGG - Intergenic
912439216 1:109686142-109686164 ACACACATGGGTCAGGAGCCAGG + Intronic
912442532 1:109710584-109710606 ACACACATGGGTCAGGAGCCAGG + Intergenic
912568701 1:110606751-110606773 TGAGATCTGGGGCGGCAGCCTGG - Intronic
912752495 1:112297289-112297311 TCACTCCTGGGCCTGCACCCTGG + Intergenic
913533891 1:119753274-119753296 ACTCACCTGGAGCAGCATCCTGG + Exonic
913961948 1:143346402-143346424 GCACAACCGAGGCAGCAGCCCGG + Intergenic
914056303 1:144171976-144171998 GCACAACCGAGGCAGCAGCCCGG + Intergenic
914122843 1:144794386-144794408 GCACAACCGAGGCAGCAGCCCGG - Intergenic
914814335 1:151052488-151052510 TCTCACCTGGGCCAGCAGGGAGG + Exonic
914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
915022706 1:152796665-152796687 TCACAGCTGGGGCAGAGCCCAGG + Intronic
915064150 1:153210753-153210775 CCTCACCTCGGGCAGCAGCAAGG + Intergenic
915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG + Intergenic
915221692 1:154379897-154379919 TCCCAGATGGGGCAGGAGCCAGG + Intergenic
915221709 1:154379976-154379998 TCCCAGATGGGGCAGGAGCCAGG + Intergenic
915221737 1:154380094-154380116 TCCCAGATGGGGCGGCAGCCAGG + Intergenic
915342759 1:155185317-155185339 CCACCCCAGGGGCAGCAGGCTGG + Intronic
915731367 1:158056545-158056567 ACACACCTGGGGCAGGTGCTGGG - Intronic
915765710 1:158359942-158359964 TCACACGTGGGGCAGGATCAAGG - Intergenic
919748962 1:201024774-201024796 CCACATCTGGGGCTGCAGCTGGG - Intergenic
919905809 1:202077614-202077636 CTTCACCTGGGGCAGCACCCAGG - Intergenic
921276180 1:213522946-213522968 TCACAACTGGGGTAGCAGTTTGG + Intergenic
923255240 1:232216350-232216372 TCTCAACTGGGGCAGGAGCATGG - Intergenic
924218276 1:241847880-241847902 CCAGAACTGGGGCTGCAGCCAGG + Intergenic
924699755 1:246439281-246439303 TCACATCTGTGGATGCAGCCAGG - Intronic
1062825564 10:565882-565904 TCACACGTTGGGAAGCAGGCAGG + Intronic
1062840778 10:669683-669705 TCACAACTGTGGCACCAGCTAGG + Intronic
1062859814 10:802711-802733 TGAGACCTGGGGCAGCACACCGG - Intergenic
1063371375 10:5525000-5525022 CCAGAGCTGGGACAGCAGCCGGG + Exonic
1063577524 10:7275138-7275160 GCAGACCTGGGGCTGCAGCGGGG + Intronic
1064626443 10:17266484-17266506 TCACACCTTGGTCACCAGGCTGG + Intergenic
1065816023 10:29483279-29483301 ACAAACCTGGGCCAGGAGCCAGG + Intronic
1066109370 10:32182649-32182671 ACCCACCCGGGGCAGCAGCTGGG - Intergenic
1067034162 10:42900536-42900558 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1067079612 10:43205676-43205698 TCCTACCTGGGGCAGCAGCAGGG + Intronic
1067086627 10:43243586-43243608 TCCCAGATGGGGCAGCGGCCAGG - Intronic
1067120076 10:43465424-43465446 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1067708313 10:48627544-48627566 TCCCATCTGGGCTAGCAGCCAGG + Intronic
1072775127 10:98183124-98183146 TCACACTGGGAGCAGCAGACTGG + Intronic
1074280588 10:112048006-112048028 TAAAACCAGGGGCTGCAGCCAGG + Intergenic
1074484931 10:113866753-113866775 TCAAACCTGGTGAAGGAGCCGGG - Intronic
1075961238 10:126569014-126569036 TGAAAGCAGGGGCAGCAGCCCGG + Intronic
1076231495 10:128823312-128823334 TCAGACCTCCTGCAGCAGCCCGG - Intergenic
1076292898 10:129361407-129361429 CAACACCTGGGGAAGCTGCCAGG - Intergenic
1076667189 10:132100065-132100087 TCAGCCCGGGGGCAGGAGCCAGG - Intergenic
1076742596 10:132494186-132494208 TCAGAGCTGGGGCAACGGCCAGG - Intergenic
1076791118 10:132777184-132777206 TCCCACCTCGGGGAGCATCCAGG - Intronic
1077511103 11:2963584-2963606 TAATGCCTGGGGCAGCAGCAGGG - Intronic
1079472467 11:20790862-20790884 TCACACCAGGTGCAGCAGGGAGG - Intronic
1081141088 11:39501198-39501220 ACACCTCTGGGGCAGGAGCCCGG + Intergenic
1081786353 11:45750531-45750553 TCTGCCCTGGGGCAGCAGCATGG + Intergenic
1082008978 11:47437882-47437904 TTACTCCTGGGGCAGCTGCCAGG - Exonic
1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1083120823 11:60510442-60510464 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1083476143 11:62916868-62916890 TCTCACCTGGGGCAGGTGGCAGG + Intronic
1083618904 11:64039364-64039386 GTACACCGGGGGCAGCAGCCAGG - Intronic
1083775755 11:64893699-64893721 GGACAGCTGGGGCAGCAGGCTGG - Intergenic
1084566408 11:69931299-69931321 TCAGGACTGGGGCAGCTGCCTGG + Intergenic
1084603548 11:70160248-70160270 TCACGCCTGGGTGAGGAGCCTGG + Intronic
1084907738 11:72361273-72361295 ACACTCCTGGGGCAGGAGCAGGG - Intronic
1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1085480866 11:76821569-76821591 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1085642306 11:78200244-78200266 CCTCACCAGGGGCAGCAGGCAGG - Intronic
1085831180 11:79902464-79902486 TCAAAGCTGAGGAAGCAGCCAGG + Intergenic
1085913823 11:80860802-80860824 TCATATCTGGGGAAGCAGCTAGG + Intergenic
1089769812 11:120794831-120794853 CCCCACCTGGGGCACCAGGCTGG - Intronic
1090476606 11:127027571-127027593 TAACAGCTGGGGCTGCAACCTGG - Intergenic
1090570203 11:128037303-128037325 TCACACCTGGGCCAGAAATCTGG - Intergenic
1092185518 12:6475730-6475752 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1094031253 12:26013531-26013553 TAACACCTGGAGTAGTAGCCAGG + Intronic
1094319669 12:29171403-29171425 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1094375984 12:29787687-29787709 TTCCTCCTGGGGCTGCAGCCGGG - Intergenic
1094525422 12:31227804-31227826 TCACAGCAGGAGAAGCAGCCAGG - Intergenic
1095068828 12:37815115-37815137 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1095738835 12:45586132-45586154 TCCCAGATGGGGCAGCGGCCGGG + Intergenic
1096413306 12:51392035-51392057 GCAAACCTGGGGCAGGACCCCGG - Intronic
1099779073 12:87171436-87171458 TCACACTGGGGGCTGCAGACCGG - Intergenic
1100409390 12:94299947-94299969 TCTGAGCAGGGGCAGCAGCCAGG + Intronic
1101316849 12:103636599-103636621 TTACAGCAGGGGCAGCAGCCAGG - Intronic
1102077781 12:110073705-110073727 TCACATCTGGGGCAACTGCCAGG - Intergenic
1103479425 12:121241509-121241531 TCACACCGGCGGCTCCAGCCTGG - Intronic
1104980121 12:132569956-132569978 TGACACCTTGGGCACCGGCCCGG - Exonic
1105640356 13:22256394-22256416 TGGCAGCTGGGGCAGCAGGCAGG + Intergenic
1108240492 13:48458162-48458184 TCACACCTGCTGCAGCAGAGAGG - Intronic
1108522891 13:51260938-51260960 TCAAACCTGAAGCAGCAGCTGGG - Intronic
1109854455 13:68108846-68108868 TAAGACCAGGGGCAGAAGCCAGG - Intergenic
1111231888 13:85354504-85354526 TCTCTCCTGGGGCCACAGCCTGG + Intergenic
1112835568 13:103510173-103510195 ACGCACGTGGGTCAGCAGCCAGG - Intergenic
1113835199 13:113324488-113324510 TCACCCCTGTGCCAGCAGCCGGG + Intronic
1113987296 13:114328321-114328343 ACACAGCTGGGGCAGGAGGCAGG - Intergenic
1114594311 14:23898475-23898497 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1114670612 14:24408933-24408955 GCACGCCTGGGACAGGAGCCAGG - Exonic
1115537750 14:34389190-34389212 TCAAAACTGGAGCAACAGCCAGG - Intronic
1115754221 14:36517429-36517451 GCACACCCGGGCCACCAGCCAGG - Exonic
1117986849 14:61395311-61395333 CCACAGCTGTGGCAGCAACCTGG + Intronic
1118336284 14:64855984-64856006 TCACTCCTCGGGCCGGAGCCTGG - Intronic
1118720884 14:68593080-68593102 TCAGAACTGGGCCAGCAGCAAGG + Intronic
1118808616 14:69258318-69258340 TCACAACAGGGGCAGGAGTCTGG - Intergenic
1118955586 14:70477691-70477713 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1118955720 14:70477993-70478015 TCCCAGATGGGGCGGCAGCCGGG - Intergenic
1119433483 14:74583409-74583431 ACACAGCTGGGCCAGCAGCTGGG + Intronic
1119665189 14:76480361-76480383 AAACACCTGGGGCAGCAGAGGGG + Intronic
1121341526 14:93107944-93107966 ACACACCGTGGGCCGCAGCCGGG + Intronic
1121736593 14:96222208-96222230 CCACACGTGGGGCAGGGGCCTGG + Intronic
1121832660 14:97065606-97065628 TGCCATCTGGGGCAGCATCCAGG + Intergenic
1122097523 14:99382350-99382372 TCACAGCTGGGGCGGCTCCCAGG - Intergenic
1122370244 14:101225554-101225576 TCACACCCTGGGCAGCCGCCAGG - Intergenic
1122769825 14:104092981-104093003 TCACACTTGCCGAAGCAGCCTGG - Intronic
1122862933 14:104590571-104590593 TCCCACCTGGGGAAGCTGCATGG + Intronic
1125230827 15:37453168-37453190 TCACAACTGTGGAAGCAGCCAGG + Intergenic
1126781753 15:52144913-52144935 AGACCCCTGGGGCAGAAGCCAGG - Intronic
1126877530 15:53060405-53060427 TCAGAACTGTGGCAGCAACCAGG - Intergenic
1128639462 15:69325382-69325404 ACCCACCTGGGCCTGCAGCCAGG + Intronic
1128779475 15:70349506-70349528 GCACACTTGGATCAGCAGCCTGG - Intergenic
1129586853 15:76876055-76876077 TAGCACCTGGGCCAGCAGCTGGG - Intronic
1129779972 15:78264051-78264073 GCACACCTTAGGCCGCAGCCTGG + Intergenic
1129792113 15:78348402-78348424 TCACACCTGGATCTGCAGTCTGG - Intergenic
1129831479 15:78673852-78673874 GGACACCTGGGGCTGCAGCATGG - Intronic
1129942855 15:79513264-79513286 AAACACCTGGGCCAGCAGCCTGG - Intergenic
1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1132092935 15:98960389-98960411 GCACACCTGGGGGAGCCACCAGG + Exonic
1132114783 15:99127509-99127531 TCACACCTTAGGCAGCAGCATGG + Intronic
1132590673 16:725044-725066 TCTCACCTGGGGCCCCATCCTGG - Intronic
1132627608 16:899177-899199 GCAGAGCTGGGGCAGGAGCCGGG - Intronic
1132875106 16:2133687-2133709 ACACACCTGGGGCCGCCGCTGGG - Intronic
1133166926 16:3954471-3954493 TCGCAGCTCGGGCAGCTGCCTGG + Intronic
1133216757 16:4297236-4297258 TCCCAGCTGGGGCTGCAGCTGGG - Intergenic
1134519881 16:14913703-14913725 ACACACCTGGGGCCGCCGCTGGG + Intronic
1134554050 16:15152534-15152556 ACACACCTGGGGCCGCCGCTGGG - Intergenic
1134707553 16:16312357-16312379 ACACACCTGGGGCCGCCGCTGGG + Intergenic
1134843231 16:17418236-17418258 ACACACCTTAGGCAGCAGCTAGG + Intronic
1134959990 16:18399768-18399790 ACACACCTGGGGCCGCCGCTGGG - Intergenic
1137251128 16:46741663-46741685 TTACACCTGGGGGCCCAGCCAGG + Intronic
1137555537 16:49468112-49468134 TCCCTCCTCGAGCAGCAGCCCGG - Intergenic
1138371828 16:56533167-56533189 TCTCGCCTTGGGCAGAAGCCTGG - Intergenic
1138607853 16:58100062-58100084 CCAAGCCTGGGGCTGCAGCCTGG + Intergenic
1139846820 16:69927327-69927349 TCTCTCCTGGGGCAGCAGAGAGG - Intronic
1140393264 16:74606689-74606711 GCACACCTGGAGCAACAACCTGG - Exonic
1141414016 16:83856039-83856061 TCATCCCTGGGGCAGCAGCCTGG - Intergenic
1141834143 16:86527512-86527534 ACACACCTGTGGCAGGAGTCTGG - Intergenic
1142192041 16:88722537-88722559 ACACACCAGGGGCAGCAGCTGGG + Intronic
1142767239 17:2071749-2071771 TCACACCTGGGTCACAAGACTGG + Intronic
1144457484 17:15430938-15430960 CCAGACCTGGGGCAGGTGCCAGG - Intergenic
1145115437 17:20205896-20205918 TCTCACCTTGGCCAGCAGACTGG - Exonic
1145234665 17:21200140-21200162 TCACTGCTGGGGCTGCAGCCGGG - Intronic
1145418137 17:22741349-22741371 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
1146904944 17:36612260-36612282 TCACTCCCTGGGCAGCAGGCTGG + Intergenic
1146936659 17:36816438-36816460 TCACACCTTGGGTGGCAGCAAGG - Intergenic
1147563359 17:41522155-41522177 TCCCAGCTGGGGGTGCAGCCAGG + Exonic
1147632611 17:41941799-41941821 TAACCCCTGGGGCAGCAGGCAGG - Intronic
1148134678 17:45284604-45284626 ACATGCCAGGGGCAGCAGCCAGG + Intronic
1148231914 17:45941473-45941495 ACACCCCTGGGGTAGAAGCCAGG - Intronic
1148799104 17:50211929-50211951 TGCAACCTGGGGCAACAGCCAGG - Intergenic
1149882637 17:60308318-60308340 TGACACCAGGGGCAGCATCTAGG - Intronic
1150010405 17:61497500-61497522 TCCCAGCTGAGGGAGCAGCCAGG + Intergenic
1150324429 17:64244861-64244883 TCACAACAGGTCCAGCAGCCAGG - Intronic
1151178876 17:72311434-72311456 TCACAGCTAGGCAAGCAGCCTGG + Intergenic
1151852706 17:76700529-76700551 TCCCACCTGGGGCAGCAGGAAGG - Intronic
1152386797 17:79979660-79979682 ACACAGCTGGGACATCAGCCCGG + Intronic
1152541758 17:80980125-80980147 TCTCCCCAGGGGGAGCAGCCAGG + Intergenic
1152657884 17:81528357-81528379 TCTGACCCGCGGCAGCAGCCTGG - Intergenic
1152904337 17:82962032-82962054 GCTCACCTGGGTCAGCCGCCCGG + Intronic
1154089615 18:11344756-11344778 TCCCAGATGGGGCAGCAGCCGGG - Intergenic
1154502007 18:15001778-15001800 GCACAGCTGGAGCAGCACCCAGG - Intergenic
1157794901 18:50564405-50564427 TCACAACTTGGGGAGCAGGCTGG - Intronic
1158888968 18:61855630-61855652 GCACACCAGGGGCTGCAGCGGGG - Intronic
1160081082 18:75727644-75727666 TCACTCATGAAGCAGCAGCCAGG - Intergenic
1161484888 19:4530171-4530193 TCTCACCTAGGGAGGCAGCCAGG - Intronic
1161495616 19:4584368-4584390 TCGGACCCGGGGCCGCAGCCCGG - Intergenic
1161778377 19:6276247-6276269 TCACACCTCAGCCAGCAACCTGG + Intronic
1161936488 19:7375652-7375674 GGATGCCTGGGGCAGCAGCCAGG + Intronic
1162730503 19:12715669-12715691 GCAGAGCTGGGGCAGCAGCTCGG + Exonic
1162823161 19:13235579-13235601 TCAGCCCTGGGCCAGCAGCAGGG + Intronic
1163114663 19:15181570-15181592 GCCCACCTGGGGCTGCAGTCGGG + Exonic
1163580646 19:18136720-18136742 TCAAACCCAGGCCAGCAGCCAGG - Intronic
1163738090 19:18994106-18994128 TCACAGCCGGGGCACCAGGCAGG + Exonic
1164017268 19:21264400-21264422 TCCCAGATGGGGCAGCGGCCAGG - Intronic
1164017330 19:21264674-21264696 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1164240571 19:23384745-23384767 GCACACCTGGGTCAGCTCCCCGG + Intronic
1164666995 19:30046823-30046845 TCAAACCTGGAGCAGCAGGGGGG - Intergenic
1165073395 19:33268267-33268289 TCACAGCTGGGGAAACGGCCAGG + Intergenic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1165741640 19:38208382-38208404 TCACTTTTGGGGCAGCTGCCTGG + Intergenic
1166083869 19:40462231-40462253 TCACACATGGGGGAGCAGCAGGG + Intronic
1167210794 19:48133047-48133069 TCCCACCCGGGGCATCAGCGAGG - Exonic
1202695786 1_KI270712v1_random:124663-124685 GCACAACCGAGGCAGCAGCCCGG + Intergenic
925339611 2:3127062-3127084 GCAGCCCTGAGGCAGCAGCCGGG + Intergenic
926059420 2:9795870-9795892 TCACACCTGGGACTGCAGCCTGG + Intergenic
930037906 2:47099345-47099367 TCACACCTGGGGCAGCAGCCTGG - Intronic
930059260 2:47274743-47274765 GAGCACCTGTGGCAGCAGCCTGG + Intergenic
932752356 2:74379474-74379496 TCACACCTGGAACAGCAGGATGG + Intronic
933136085 2:78737502-78737524 TCACATCTTGGGCAACTGCCAGG - Intergenic
934276948 2:91581701-91581723 GCACAACCGAGGCAGCAGCCCGG + Intergenic
934857325 2:97737499-97737521 GGACACCTGGTGCAGCAGCTCGG - Exonic
934877331 2:97936381-97936403 TCACACCTGGGGCTGACCCCAGG + Intronic
935128065 2:100241365-100241387 TCACCACTGGGGCAGGAACCAGG + Intergenic
936937739 2:117854175-117854197 TCACAGCAGGGGCACCAGCTAGG + Intergenic
938055130 2:128208842-128208864 TCCCAGATGGGGCGGCAGCCGGG - Intergenic
938055259 2:128209432-128209454 TCCCAGATGGGGCGGCAGCCGGG - Intergenic
938501185 2:131831948-131831970 GCACAGCTGGAGCAGCACCCAGG - Intergenic
938656762 2:133442596-133442618 TCAGCCCTGGGGCAATAGCCTGG - Intronic
943060624 2:183038397-183038419 CCACACCTAGTGGAGCAGCCGGG - Exonic
943125756 2:183792284-183792306 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
943297188 2:186154207-186154229 TCTCACACGGGGCAGCTGCCAGG + Intergenic
944379600 2:199092624-199092646 CCACAGCTGGGGCCACAGCCAGG + Intergenic
946166625 2:217868356-217868378 TCACACCTGGGGATGGAGCCTGG + Intronic
946740543 2:222796825-222796847 TCAGCTCTTGGGCAGCAGCCTGG - Intergenic
946791342 2:223303517-223303539 TCATTCCTGAGGCAGCAGCCTGG + Intergenic
947135280 2:226971219-226971241 TCACACCTGTGGCAGAACCGAGG + Intronic
947671813 2:231941779-231941801 TCACACTTGGCCCAGCACCCAGG - Intergenic
947810872 2:233003247-233003269 CCCCACCTGGGGCAGCCACCAGG - Intronic
948034370 2:234846460-234846482 CCACACCCTGGGCAGGAGCCTGG + Intergenic
948306654 2:236953343-236953365 TTCTTCCTGGGGCAGCAGCCAGG + Intergenic
948455356 2:238102147-238102169 TCCCGCCTGGGGGGGCAGCCTGG + Intronic
948481908 2:238255416-238255438 TCCCACCTCGGGCACTAGCCTGG + Intronic
948540782 2:238690262-238690284 GCCATCCTGGGGCAGCAGCCCGG + Intergenic
948703309 2:239774275-239774297 TCCCACCTGTGACAGCATCCTGG - Intronic
1169451865 20:5718763-5718785 TCACACCTGGCACTCCAGCCTGG + Intergenic
1169746783 20:8951314-8951336 CCACACCAGGAGAAGCAGCCGGG + Intronic
1169959717 20:11145804-11145826 TCACTTCTGGGGCAGAGGCCAGG - Intergenic
1171034562 20:21705190-21705212 CCACTCCCGGGGCAGCGGCCGGG - Intergenic
1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1172035476 20:32007865-32007887 CCACCCTTGGAGCAGCAGCCGGG - Intergenic
1172764294 20:37342959-37342981 TCACCCTTGCTGCAGCAGCCAGG - Intergenic
1172996246 20:39072319-39072341 ACACACCTGTGGCAGGAGCAGGG - Intergenic
1173793019 20:45840507-45840529 TCACCCCTGGGACAGCACCCAGG - Intronic
1173808773 20:45943429-45943451 TCTCGCCTGGGGCAGAAGACAGG - Intronic
1173839927 20:46150741-46150763 CAAGACCTGGGGCAGCATCCTGG - Intergenic
1175306580 20:57979917-57979939 TGACGTCTGGGGCAGCCGCCGGG + Intergenic
1175458252 20:59131361-59131383 TCACACCTGGACCAGGACCCTGG - Intergenic
1176013134 20:62911216-62911238 TCACAGCTGTGGAAGCAGACTGG + Exonic
1176075903 20:63248120-63248142 CCACACCTGGGGCTGCAGCCGGG - Intronic
1176120095 20:63450416-63450438 CCACACCTGGGGCAGCCCCAGGG - Intronic
1178391053 21:32198658-32198680 TGCCACTTGGGGCAGCAGCCAGG - Intergenic
1178404394 21:32312423-32312445 TCACATCTGGGGGAGCCGGCGGG - Exonic
1178531569 21:33380754-33380776 CAACGCCTGGGGCAGCAGCCAGG + Intergenic
1178622302 21:34187302-34187324 TCACTCCTGGGTCAGAAGACAGG + Intergenic
1179562454 21:42224255-42224277 AAACACCTGGGGCAGCAGCATGG + Intronic
1179605913 21:42514797-42514819 TCAAACCTGGGGCCGCGGGCTGG - Intronic
1180072573 21:45443664-45443686 TCACATCCCGGGCTGCAGCCGGG + Intronic
1180190083 21:46158782-46158804 TGTCTCCTGGGGCAGCACCCGGG - Intergenic
1181015566 22:20066612-20066634 TCAGGCCTGGGGGTGCAGCCTGG - Intergenic
1181092051 22:20480510-20480532 TCACACCAGAGGCAGCATACTGG - Intronic
1181122844 22:20683685-20683707 TCTCACCTGGGGCACCTGCCTGG - Intergenic
1181179581 22:21057404-21057426 TCTCACCTGGGGCACCTGCCTGG + Intronic
1181278440 22:21702174-21702196 CCACACCTGGGGCTGCCGCTTGG - Intronic
1182073430 22:27478834-27478856 ACACACCTGGAGCAACACCCAGG + Intergenic
1182399806 22:30066778-30066800 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1182508719 22:30803480-30803502 TCCCCCCTGTGGCACCAGCCTGG - Intronic
1183539187 22:38419731-38419753 TCAGGCTTGGGACAGCAGCCAGG - Intergenic
1184101933 22:42345274-42345296 TGACTCCTGGGGCAGGTGCCGGG + Intergenic
1184739494 22:46419179-46419201 AAACACCTGGGGGAGTAGCCTGG - Intronic
1184770473 22:46594177-46594199 ACAGAGCTGGGGCAGGAGCCGGG - Intronic
950110672 3:10416898-10416920 TCCCAGATGGGGCGGCAGCCGGG + Intronic
950110795 3:10417340-10417362 TCCCAGATGGTGCAGCAGCCGGG + Intronic
950227842 3:11250445-11250467 TCACAACTGAGACAGCAGTCCGG - Intronic
950965826 3:17145123-17145145 TCATACCGGGGCCAGCAGCAAGG - Intergenic
951006281 3:17618986-17619008 TCACACTTGGAGCTGCAGACCGG + Intronic
952386938 3:32848731-32848753 TGAAACCTGGGGCAGTGGCCAGG + Intronic
952613468 3:35240287-35240309 TCTGAACTGGGGCAGCAGCAGGG + Intergenic
953566018 3:44032712-44032734 TCACATCTGTGGCTGCAGGCAGG - Intergenic
954235990 3:49257519-49257541 TGAAAACTGAGGCAGCAGCCTGG + Exonic
954456998 3:50605084-50605106 CCTCACCTGGTGCTGCAGCCTGG - Intergenic
956127788 3:66027540-66027562 TCTCACCTAGGTCAGCAGTCAGG + Intronic
959947141 3:112137135-112137157 CCACACATGGAGCAGCATCCAGG - Intergenic
960625010 3:119674010-119674032 TCCCAGACGGGGCAGCAGCCGGG - Intronic
960862007 3:122164491-122164513 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
961119533 3:124361950-124361972 TCACACCTGGACCAGCAGGAAGG - Intronic
961390293 3:126548660-126548682 TCCCACCTGGGGAGGGAGCCTGG + Intronic
962102438 3:132356750-132356772 GGACAGCTGGGGCTGCAGCCAGG - Exonic
962344631 3:134610226-134610248 CAGCACCTGGGGCAGCGGCCTGG - Exonic
962602864 3:137007872-137007894 TCACACTGGGGGCTGCAGACTGG + Intronic
962702123 3:138010163-138010185 TCACACCTTCGGCAGCAGGAGGG + Exonic
962888865 3:139653653-139653675 TCCCAGCTGGGGCATAAGCCAGG + Intronic
964124168 3:153218535-153218557 TCACATCTGGGGCTACAGCTAGG - Intergenic
964927096 3:161973028-161973050 TTATAACTGGGCCAGCAGCCTGG - Intergenic
965302362 3:167018903-167018925 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG + Intergenic
967529212 3:190529900-190529922 TCCTAGATGGGGCAGCAGCCAGG - Intronic
967978043 3:195046343-195046365 TAACCCCAGGGCCAGCAGCCAGG + Intergenic
968944573 4:3656850-3656872 TCAGGCCTGGGCCAGGAGCCAGG - Intergenic
968962398 4:3752298-3752320 TCCCACCCAGGGAAGCAGCCTGG + Intergenic
969031891 4:4222255-4222277 TCAGACCAGGGGCAGCCCCCAGG - Intronic
969219418 4:5749871-5749893 TCACACCTGGAGGAGCAGAGCGG - Intronic
969323414 4:6426693-6426715 GCAGAGCTGGGACAGCAGCCTGG + Intronic
969577740 4:8046383-8046405 TCACTCCTGGGCCACCTGCCTGG + Intronic
970007672 4:11427230-11427252 ACACTGCTGAGGCAGCAGCCTGG - Intronic
970092975 4:12430612-12430634 TCTCCCTTGGGGGAGCAGCCAGG - Intergenic
970604678 4:17667956-17667978 CAGCTCCTGGGGCAGCAGCCAGG + Intronic
970766973 4:19561664-19561686 TCAGACCTGGGGCAAAATCCTGG - Intergenic
973650437 4:52992746-52992768 TCACACATGGGGCGGCTGCCGGG - Intronic
973664132 4:53139603-53139625 TCCCAGACGGGGCAGCAGCCGGG - Intronic
974877402 4:67716125-67716147 CCAGCCCTGGGGCAGCAGTCGGG + Intergenic
978198398 4:105996955-105996977 CCACCACTGGGTCAGCAGCCAGG + Intronic
978376261 4:108077721-108077743 TCCCAGATGGGGCAGCAGCCGGG - Intronic
979296307 4:119036143-119036165 TCACAACTGGCCCAGCAGGCAGG + Intronic
979665332 4:123304755-123304777 GAACAGCGGGGGCAGCAGCCAGG + Intronic
979702555 4:123685153-123685175 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
982017308 4:151167798-151167820 TCCCAGATGGGGCGGCAGCCAGG - Intronic
982723509 4:158882304-158882326 TCCCAGATGGGGCAGCTGCCGGG - Intronic
983801025 4:171929901-171929923 TCACACCTGGCCCAACAGCCGGG + Intronic
985078348 4:186240956-186240978 CCACACCTGGGAGAGCACCCTGG + Intronic
985937824 5:3110321-3110343 ACACACTGGGGGCAGGAGCCGGG - Intergenic
986251781 5:6066208-6066230 TCACACTGGGAGAAGCAGCCAGG + Intergenic
986739309 5:10692297-10692319 TCAGAACTGGGGCAGAAACCAGG - Intronic
987017315 5:13833926-13833948 TAACAGCTGGGGCAGCTCCCTGG - Intronic
987195014 5:15517575-15517597 TCACACCTGGAGAGGCAGACAGG + Intronic
988617369 5:32788036-32788058 TCACACATGGGCCAGCATCTGGG - Exonic
988760671 5:34306906-34306928 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG + Exonic
992494983 5:77282981-77283003 TCCAACCTGGGCCTGCAGCCAGG + Intronic
995341996 5:111070746-111070768 TGTCACCTGGGGCCTCAGCCCGG - Intronic
995474480 5:112534119-112534141 TCACACATGGGGTGGCAGCCTGG - Intergenic
998436032 5:142109221-142109243 TCCCACCTGGGGTCGCAGACGGG - Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999256204 5:150211178-150211200 TCAGACCCAGGGCAGAAGCCAGG - Intronic
1001706467 5:173744504-173744526 ACACTCCTGGGCCAGCATCCTGG - Intergenic
1002452375 5:179326242-179326264 GCATTCCTGGGGCAGCTGCCCGG - Intronic
1004293910 6:14392965-14392987 TCACACCATGGGAAGCATCCCGG + Intergenic
1004507498 6:16258935-16258957 TCACTCCTGGTGCAGAGGCCAGG - Intronic
1004853050 6:19720035-19720057 TCACTCCTGGGGGAGCACGCAGG + Intergenic
1006359198 6:33578052-33578074 CCACTCCTGGGGCAAGAGCCTGG + Intronic
1006400417 6:33814153-33814175 TCACACCCGGGCCAGCAGGTGGG - Intergenic
1006638787 6:35478287-35478309 CCTCTCCTGGGACAGCAGCCTGG - Exonic
1006738833 6:36293188-36293210 TCACACCTGGGGGAGCAGGGGGG + Intronic
1007395358 6:41574752-41574774 ACACATCTGGTGCAGCAGCGTGG + Intronic
1007685810 6:43666721-43666743 TCTGACCTTGGGCTGCAGCCAGG + Intronic
1008572047 6:52825587-52825609 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
1008909946 6:56721202-56721224 TCCCAGATGGGGCAGCTGCCAGG + Intronic
1010821357 6:80419382-80419404 TCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1014568621 6:122981583-122981605 TCACTCCCTGGGCAGCAGCTTGG - Intergenic
1016345687 6:143111746-143111768 TTTCTCCTGGGCCAGCAGCCTGG + Intronic
1017405642 6:154115727-154115749 TCTGCCCTGGGGCAGCAACCTGG + Intronic
1017929529 6:158939706-158939728 TCCCACCTGGGTCAGCCTCCGGG + Intergenic
1018734655 6:166678666-166678688 TCACGCCTGGAGAAGCAGCAAGG + Intronic
1019261147 7:82621-82643 CTACACCTGGGGCTGCAGCCGGG - Intergenic
1019296252 7:276864-276886 TCACACCGGCTGCAGCAGGCAGG - Intergenic
1019364882 7:628157-628179 GCACCCCTGGGGCAGCAAACAGG + Intronic
1019645358 7:2126028-2126050 CCACAGGTGGGGCTGCAGCCCGG + Intronic
1019702032 7:2478697-2478719 TCCCTCCTGGGGCGGGAGCCAGG + Intergenic
1019729617 7:2622884-2622906 TCCCAGCTGGGCCTGCAGCCTGG - Intergenic
1019823309 7:3262557-3262579 CCACACATGGGGAAGCAGACAGG - Intergenic
1020118148 7:5487831-5487853 CCGCACCTGGTGCAGCACCCAGG - Intronic
1020143463 7:5624917-5624939 TCTGTCCTGAGGCAGCAGCCCGG - Intronic
1020492891 7:8811294-8811316 TCACCCCTGTGGGAGCAGGCTGG - Intergenic
1021120501 7:16790626-16790648 TCACAGATGGGGTAGCGGCCGGG + Intergenic
1022103607 7:27183499-27183521 TAACATCTGGGGCGGCTGCCGGG + Intronic
1023157574 7:37266078-37266100 TCTGTCCTTGGGCAGCAGCCTGG + Intronic
1023326775 7:39069360-39069382 TCACAGCCTGGGCATCAGCCCGG - Intronic
1023357540 7:39382395-39382417 TCAGACCTGGGCCAGCAGGATGG + Intronic
1023561190 7:41474777-41474799 TCTCTCCTGAGGCTGCAGCCAGG - Intergenic
1023870750 7:44261954-44261976 GCCCACCTGGGGCTGCAGCCTGG + Intronic
1024063836 7:45717157-45717179 CCACACCTTGGGCAGCTTCCAGG - Exonic
1024868099 7:53926928-53926950 TGACACCAGGAGCAGCACCCTGG - Intergenic
1025190712 7:56893565-56893587 TCCCTCCTTGGGCAGGAGCCTGG + Intergenic
1025681231 7:63683359-63683381 TCCCTCCTTGGGCAGGAGCCTGG - Intergenic
1026186189 7:68083485-68083507 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1026521042 7:71118537-71118559 TCAGAGCTGGATCAGCAGCCGGG - Intergenic
1028910884 7:96206233-96206255 TCACAGCTTTGGCATCAGCCAGG + Intronic
1033150622 7:138912092-138912114 TCAGACCAGAGGCAGCAGTCTGG - Intronic
1034421837 7:150994773-150994795 TCACACATGGGGCTGCTGTCAGG + Intronic
1035272813 7:157730478-157730500 TCACCCCTGGGGCACCACCTCGG - Intronic
1035850485 8:2914834-2914856 TCCCAGCCGGGGCATCAGCCAGG + Intergenic
1036660152 8:10702569-10702591 ACCCACCTGAGGCAGCAGCAGGG + Intronic
1036665014 8:10732306-10732328 CCACCGCTGGGGCAGCATCCTGG + Intronic
1038250546 8:25899983-25900005 ACACACCTGGCGCATCTGCCAGG - Intronic
1040043526 8:42939759-42939781 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1040917002 8:52573643-52573665 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG + Intronic
1045021904 8:98051790-98051812 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1045545803 8:103126964-103126986 TCACTCTTGGGCCAGCAGCGAGG - Intergenic
1045942119 8:107751451-107751473 ACACACATGTGGCAGCAGGCTGG - Intergenic
1046686724 8:117236025-117236047 TCACACCAAAGCCAGCAGCCAGG - Intergenic
1047289995 8:123521438-123521460 CCACTCCTGGGGCATCAGTCTGG - Intronic
1047523669 8:125614969-125614991 TCACATCTTGGGCAGCAGCTGGG + Intergenic
1048368289 8:133757314-133757336 TCACAGATGGGGTAGCGGCCGGG - Intergenic
1048776269 8:137950103-137950125 GCACTCCTGGTGCAGCAGCCTGG - Intergenic
1049204697 8:141358338-141358360 GCACAGCTGGGGCTGGAGCCAGG - Intronic
1049377062 8:142294294-142294316 TAACACCTGGGGAAACAGCAAGG + Intronic
1049812389 8:144581348-144581370 TCGCAGCTGGGGCTGGAGCCGGG - Intronic
1050387004 9:5101299-5101321 CCACCCGTGAGGCAGCAGCCTGG + Intronic
1051366389 9:16324352-16324374 CCAGACCAGGGGCAGCATCCAGG - Intergenic
1051383287 9:16480592-16480614 CCACACTTGGAGCAGCAGGCCGG + Intronic
1051439842 9:17072689-17072711 CCACACTTGGAGCAGCAGGCTGG + Intergenic
1051692731 9:19733532-19733554 TCACACCTCGCTCAGCACCCAGG + Intronic
1055580464 9:77702780-77702802 TCCCAGATGGGGCGGCAGCCGGG + Intergenic
1056100198 9:83293643-83293665 TCATACCTGGGATATCAGCCTGG - Intronic
1056487051 9:87069743-87069765 TCACACTTCTGGCTGCAGCCAGG + Intergenic
1056538382 9:87551025-87551047 CCCCACCTTGGCCAGCAGCCGGG + Intronic
1056572494 9:87828204-87828226 TCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1057693998 9:97310868-97310890 GCCCACCTGGGGCATCAGGCAGG - Intronic
1058569478 9:106325045-106325067 TCACAGATGTGGCTGCAGCCTGG - Intergenic
1058722519 9:107776155-107776177 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1059201594 9:112422515-112422537 TAACACCTGGGTAAGCAGCTTGG + Intronic
1059417175 9:114169225-114169247 TCAGACCTGGGAAGGCAGCCAGG + Exonic
1060064897 9:120495543-120495565 TCTCAGATGGGGCAGCTGCCGGG - Intronic
1060230943 9:121824828-121824850 TGGCACTGGGGGCAGCAGCCTGG + Intronic
1060375335 9:123111660-123111682 CCACACCTGGCACTGCAGCCAGG + Intronic
1060777858 9:126389743-126389765 CCACACTTGGGACAGCAACCTGG - Intronic
1061495836 9:130973737-130973759 TGACAGCTGGGGCAGGAGGCCGG - Intergenic
1062081744 9:134627713-134627735 TCCCACCTGGGGTGGAAGCCGGG + Intergenic
1062286500 9:135775293-135775315 ACATACCTGGGGCAGGAGACAGG - Exonic
1062503069 9:136859488-136859510 TCACCCCTGGGGCCGCTGCCTGG + Intronic
1062541510 9:137043692-137043714 CCACACCAGGGGCTGCAGTCAGG + Intronic
1186840060 X:13476591-13476613 TCCCATCTGGGTCATCAGCCTGG + Intergenic
1187447971 X:19374441-19374463 GGACAGCTGGGGCAGCACCCTGG - Intronic
1188473270 X:30563571-30563593 TCACACCTGGCCATGCAGCCAGG + Intronic
1189160788 X:38805868-38805890 CCACACTTGGGAAAGCAGCCCGG + Exonic
1190906907 X:54736786-54736808 TCCCAGATGGGGCAGCGGCCGGG - Intergenic
1191069004 X:56380362-56380384 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1191069014 X:56380402-56380424 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1192761308 X:74098529-74098551 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1195729270 X:107949277-107949299 TGACCCGTGAGGCAGCAGCCTGG - Intergenic
1198189132 X:134286023-134286045 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1199836700 X:151599342-151599364 TCCCAGATGGGGCAGCGGCCGGG + Intronic
1200120803 X:153789669-153789691 TCACACCTAGGGCCCCATCCTGG + Intronic
1200134646 X:153868995-153869017 CCACAGCTGGGCCAGGAGCCAGG + Intronic
1201556306 Y:15267382-15267404 TCACACTTGGAGCAGCCGCCCGG + Intergenic