ID: 930044137

View in Genome Browser
Species Human (GRCh38)
Location 2:47154382-47154404
Sequence CAGAATAAGGAAAATGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 807
Summary {0: 1, 1: 1, 2: 3, 3: 58, 4: 744}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930044126_930044137 -7 Left 930044126 2:47154366-47154388 CCTCCCACCCCTACCCCAGAATA 0: 1
1: 1
2: 8
3: 168
4: 1817
Right 930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG 0: 1
1: 1
2: 3
3: 58
4: 744
930044127_930044137 -10 Left 930044127 2:47154369-47154391 CCCACCCCTACCCCAGAATAAGG 0: 1
1: 0
2: 2
3: 31
4: 340
Right 930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG 0: 1
1: 1
2: 3
3: 58
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930044137 Original CRISPR CAGAATAAGGAAAATGAGAT GGG Intronic
901277993 1:8007947-8007969 CAAAATCAGGAAACTGACATTGG - Intronic
901885635 1:12220988-12221010 CAGAACAAGGAGCATGTGATTGG - Intergenic
902075812 1:13784665-13784687 CAAAATAATGAAAATGAACTGGG - Intronic
902139525 1:14341187-14341209 AAAAATAAGGAAAATCAGCTGGG - Intergenic
902213183 1:14918202-14918224 CAGAATAGGGAGAACAAGATGGG + Intronic
902687136 1:18085591-18085613 TAGAATAGGGAAAAAGTGATGGG - Intergenic
902711043 1:18239972-18239994 CAGAATAAGAACAATGGGCTGGG + Intronic
903085637 1:20855530-20855552 AAGAATAAGAAGAAAGAGATTGG + Intronic
904357828 1:29952626-29952648 CAAAATCAGGAAATTGACATGGG - Intergenic
904823566 1:33260137-33260159 CAGAATGAGGCAAATGATCTGGG + Intronic
905683101 1:39888686-39888708 CAGAAAAAGGAACATGCTATGGG + Intergenic
905850912 1:41274144-41274166 CAAAATCAGGAAAGTGACATTGG + Intergenic
905928461 1:41768994-41769016 CAGCACAAGGGACATGAGATTGG - Intronic
906862720 1:49379027-49379049 CTGGATAAGGAAAATGTGGTAGG + Intronic
908022778 1:59915542-59915564 GAGAATAAGGAAATAGAGACAGG + Intronic
908274750 1:62458691-62458713 AAAAATAAGGAAAATTAGCTGGG - Intronic
908797370 1:67844101-67844123 TAGAAGGAGGAAAATGAGAGAGG - Intergenic
909108108 1:71438735-71438757 CAGACTATCGAAAGTGAGATGGG + Intronic
909347032 1:74602424-74602446 TAGAAGAAGGCAAATGGGATGGG - Intronic
909469931 1:76016048-76016070 CAGAAAAAGTAAAATGCTATTGG - Intergenic
909838024 1:80282392-80282414 CAGAAGAAGTAAAATGAAACTGG - Intergenic
910082904 1:83363121-83363143 AATAATAATGAAAATGAGAGTGG - Intergenic
910457819 1:87416392-87416414 GAGAAAAAGTAAAATGAAATTGG - Intergenic
911340466 1:96630137-96630159 CAAAATAGCTAAAATGAGATTGG + Intergenic
911761334 1:101620842-101620864 CAGAAAAAGAAAAAAGAGAGTGG - Intergenic
911923922 1:103802902-103802924 CAGAATAAGTTAAATCAGGTTGG + Intergenic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
913096387 1:115521083-115521105 TAGAATAAGGAAAATGAGTAAGG - Intergenic
913720994 1:121594477-121594499 CAAAAGAAGGAAATTGACATTGG - Intergenic
914315089 1:146502866-146502888 GAGAAAAAGTAAAATGAAATTGG - Intergenic
914387827 1:147188941-147188963 GAGAAGAAGGAAAATGAAGTTGG + Intronic
914406414 1:147378287-147378309 CAGAATGAGGAAAAACATATAGG - Intergenic
914499265 1:148230505-148230527 GAGAAAAAGTAAAATGAAATTGG + Intergenic
915708957 1:157875050-157875072 GAGAGTAAGGAAATTGGGATAGG - Intronic
915919900 1:159968308-159968330 AAGAATTACAAAAATGAGATGGG - Intergenic
917804473 1:178601081-178601103 CAGAATATGGCAAATGTGATGGG - Intergenic
918094601 1:181324384-181324406 CAGAATGATAAAAATGAAATAGG + Intergenic
918157374 1:181862169-181862191 CTGGATCAGGAAAATGAGATAGG + Intergenic
918391949 1:184074616-184074638 CAGAATACGGCAAAGGTGATGGG - Intergenic
918841951 1:189552506-189552528 CAAAATAAATAAAATGATATTGG - Intergenic
919002438 1:191849958-191849980 CAGACTAAGGAAAAAGAAAGGGG - Intergenic
919030587 1:192237260-192237282 TAGAAAAAGGAAAATTAGATGGG + Intergenic
919087588 1:192938860-192938882 CAGAAAAAGGAAAATAAGCAGGG + Intergenic
919090434 1:192972067-192972089 AAGAAGAAGGAAAATGCTATGGG + Intergenic
919676385 1:200387718-200387740 CAGAGTAAGAAAAAGGAGATGGG + Intergenic
920257717 1:204667242-204667264 CAAAACAAGGAAACTGACATTGG - Intronic
920618257 1:207516708-207516730 CAGAATAAAGATAATGAAATAGG - Intronic
920652209 1:207846553-207846575 CAGAATAAGTACAATGAAAAAGG + Intergenic
921005230 1:211086489-211086511 CATGATCAGGAAAATGAGAGGGG + Intronic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921311149 1:213845064-213845086 CAAAACAAGGAAAATTACATGGG + Intergenic
921441414 1:215190887-215190909 CAGAATATTCAAAATCAGATTGG - Intronic
921495504 1:215835883-215835905 AAGAACAAGGAAAGTGAGAGAGG - Intronic
921546952 1:216484407-216484429 CTGAGGGAGGAAAATGAGATAGG + Intergenic
921628579 1:217405327-217405349 CATAAAAAAGCAAATGAGATGGG - Intergenic
922493099 1:226034420-226034442 CAGAATATGGCAAAGGTGATGGG + Intergenic
922710906 1:227831038-227831060 GAAAATAAGAAAAATGAGAGTGG - Intronic
922956885 1:229610449-229610471 CAGGATAAGGTGAATGAGAGAGG + Intronic
923439597 1:234003816-234003838 CAAAAAAAGGAAAATCAGAATGG + Intronic
923932263 1:238714458-238714480 CAGAATATGGAAAGTTTGATAGG - Intergenic
924219974 1:241864325-241864347 CAGGATAGGGAAAGTGAGTTGGG + Intronic
924247927 1:242103080-242103102 GAGAATTTGGAAAAGGAGATTGG + Intronic
924374681 1:243392925-243392947 CAAATTAAAGAAAATGAAATGGG + Intronic
924427497 1:243966257-243966279 TAAAATAAGGAAAATGAAGTAGG - Intergenic
924753368 1:246918878-246918900 CAGAAAAAAGAAAAAGTGATTGG + Intronic
1063651905 10:7946380-7946402 CTGATTAATGAAACTGAGATGGG - Intronic
1064165068 10:12978747-12978769 CAGAATAAGGAAATGGAAAGAGG + Intronic
1064353935 10:14601290-14601312 CGGAATTAGGGATATGAGATGGG + Intronic
1065101087 10:22334340-22334362 GAAAATAAGGAAAAGGAGAGAGG - Intergenic
1065385279 10:25127845-25127867 GAGAATAAGCAAAAAGGGATGGG + Intergenic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065583575 10:27195747-27195769 AAAAATAAGGAAAAAGAGTTTGG + Exonic
1065627120 10:27641622-27641644 TACACTAAGGAAAATGAGAAAGG - Intergenic
1065947923 10:30624287-30624309 CAGAAGAAGGACACTGAGGTTGG + Intronic
1066022133 10:31314387-31314409 CAGAGAAAGGAAAAAGAGAGAGG - Intergenic
1066511308 10:36099768-36099790 AAGGAGAAGGAAAATGATATAGG + Intergenic
1067485576 10:46646736-46646758 CAGAATAAGGACTAGGAGCTGGG - Intergenic
1067609183 10:47694916-47694938 CAGAATAAGGACTAGGAGCTGGG + Intergenic
1068034495 10:51742827-51742849 CAGAATGAGGAATCTGGGATTGG + Intronic
1068448469 10:57154392-57154414 CAGATGAAGGGAAATGTGATAGG - Intergenic
1068450718 10:57183623-57183645 CAGATTAAAGAAAATGGGGTGGG + Intergenic
1068698470 10:59994871-59994893 CAGAATAATGAAAATAACAGAGG + Intergenic
1068868753 10:61921604-61921626 CAGAATTAGGCAAAAGTGATGGG - Intronic
1069704509 10:70449702-70449724 TTGAAGAAGGACAATGAGATGGG - Intergenic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1070241569 10:74687034-74687056 CATAATAACCCAAATGAGATAGG - Intronic
1070463659 10:76695691-76695713 CAGAATAAGGAAAATTATCAGGG - Intergenic
1070973142 10:80583990-80584012 CAGAAGAATGAGAATCAGATTGG + Intronic
1071069535 10:81675460-81675482 CAGCAAAAGGAAAAAGAGCTTGG + Intergenic
1071624770 10:87156562-87156584 CAGAATAAGGACTAGGAGCTGGG + Intronic
1072164654 10:92801654-92801676 CAGAATGGGGAAAATGGGAAAGG - Intergenic
1073379462 10:103066718-103066740 CAGCATGAGGAAAAAGACATTGG - Intronic
1074174168 10:110979368-110979390 CAGAATATGGCAAAGGTGATGGG - Intronic
1074310801 10:112321660-112321682 AAGAATCAGAAAAATGACATAGG + Intergenic
1075064600 10:119281071-119281093 CAGAAAACGGGAAATCAGATGGG - Intronic
1078127201 11:8579067-8579089 CAGAATAAGAAAAAAGAAAAAGG - Intronic
1078450315 11:11436099-11436121 CAGGGTAAGGAAGATGATATGGG + Intronic
1078630063 11:12994306-12994328 AAAAATAAGGAAACTGAGGTTGG - Intergenic
1078733467 11:13998272-13998294 CAGAATAGAGAAAATGACACAGG - Intronic
1078848209 11:15140738-15140760 AAGAAAAAGAAAAATTAGATGGG - Intronic
1079263215 11:18904163-18904185 CAAAACCAGGAAAATGACATTGG - Intergenic
1079301384 11:19282233-19282255 CAGAATATGGCAAAAGTGATGGG + Intergenic
1079536476 11:21521001-21521023 CAGAATAGGGTATGTGAGATAGG - Intronic
1079640907 11:22804288-22804310 CAGAGAAAGAACAATGAGATAGG + Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079740775 11:24057163-24057185 AAGAATAAAGAAAATGAGGTAGG + Intergenic
1079990827 11:27244831-27244853 CAGGATAAGAAAGATGAGAGAGG + Intergenic
1080062773 11:27974518-27974540 CAGAGGAAGGTAAAGGAGATTGG - Intergenic
1080279071 11:30535725-30535747 CAGAATGAGTGAGATGAGATGGG + Intronic
1080696714 11:34609018-34609040 AAGAATTAGGAAACTGAGATTGG + Intergenic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1081004765 11:37721916-37721938 TTGAAAAAGGAAAATGAGATTGG - Intergenic
1081126319 11:39327569-39327591 CAGAAAAAGGAAAGTGACATAGG - Intergenic
1081389064 11:42507574-42507596 CAAAATAAGGAAAATGAAGAGGG + Intergenic
1081680140 11:44996692-44996714 CAAAATCAGGAAAATGACATTGG - Intergenic
1081682914 11:45021388-45021410 CAAAATCAGGAAATTGACATTGG - Intergenic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1082983550 11:59145620-59145642 CAAAAAAAGGAAAATAAAATGGG - Exonic
1083689555 11:64398940-64398962 AAGACAAATGAAAATGAGATGGG + Intergenic
1084329153 11:68420082-68420104 CAGAATAGGTAAAATGGGCTGGG - Intronic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1085007384 11:73105295-73105317 GAGAATAAGGACAATGAAACAGG + Intronic
1085738732 11:79061783-79061805 CACAGCAAGCAAAATGAGATTGG - Intronic
1086363608 11:86085784-86085806 CAAGAGAAGGAAAATGATATAGG - Intergenic
1086762517 11:90650537-90650559 CTGGATAAAGAAAATGTGATGGG + Intergenic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1087141889 11:94772154-94772176 CAGAACCAGGAAATTGACATTGG + Intronic
1087446759 11:98265413-98265435 TAGACTAAGGAAAAAGAGAAAGG + Intergenic
1087466079 11:98508092-98508114 GAGAGAAAGGAAAATGAGAGAGG - Intergenic
1087850696 11:103024990-103025012 AAGAATGAGAAGAATGAGATGGG + Intergenic
1087984096 11:104656250-104656272 AAGAATAAGAACAAAGAGATGGG + Intergenic
1088042405 11:105403214-105403236 CAGAAAAAGGAAAAAGAAAAAGG + Intergenic
1089087515 11:115835594-115835616 CACAATTAGGAAACTGACATTGG - Intergenic
1089222977 11:116890699-116890721 CAGAATAAAAAAAATTAGATTGG - Intronic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1090151107 11:124385420-124385442 CAAAATCAGGAAACTGACATAGG + Intergenic
1090428917 11:126629692-126629714 CGGAAATAGGAAAATGAGGTTGG + Intronic
1091066011 11:132513659-132513681 CAAAAGAAGGAAAATGAAATGGG - Intronic
1091129863 11:133136636-133136658 GAGAATAGGGAAAAGGAGAAAGG + Intronic
1091439490 12:501586-501608 AAGAAAAAGGAAAAAGAAATAGG + Intronic
1091584296 12:1807088-1807110 CAGAATATGGTAAAAGTGATGGG + Intronic
1092684877 12:11031608-11031630 CAAAAAAAGGAAAATGGGAGGGG - Intronic
1092999843 12:13983848-13983870 CTGAATACAGAAAATGAGAGTGG - Intergenic
1093410011 12:18853710-18853732 TGGAATAAGGAGTATGAGATGGG - Intergenic
1095157557 12:38876949-38876971 CACATTAAGTAAAATAAGATAGG + Intronic
1095297434 12:40542908-40542930 CAGAATGAGCATTATGAGATTGG + Intronic
1095338180 12:41055390-41055412 CACACTAAGGAAGAAGAGATGGG - Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096604926 12:52757851-52757873 AAGAAAAAGGAAAATCAGGTGGG - Intergenic
1097081838 12:56437514-56437536 CAGAATACAGAAAATGAGGCAGG + Intronic
1097395213 12:59064866-59064888 CTGAATAAGGAATATGCTATAGG + Intergenic
1097611650 12:61830589-61830611 CAGAAAAATGGGAATGAGATGGG + Intronic
1097651104 12:62298189-62298211 CAGAAGGAGGAAAGTGAGAGGGG + Intronic
1098077554 12:66749215-66749237 TGGAATTATGAAAATGAGATTGG - Intronic
1098198968 12:68034755-68034777 CAGAAAAAGGGAAGTGACATAGG - Intergenic
1098562849 12:71896376-71896398 CAGAATAAGGCAAATGCCACTGG - Intronic
1098705343 12:73681329-73681351 AAGAAGAAAAAAAATGAGATGGG - Intergenic
1098946004 12:76590214-76590236 AAGAATAAGGCAAAGGTGATAGG + Intergenic
1099261909 12:80393401-80393423 TAAAATACGGAAAATGAAATGGG - Intergenic
1099310720 12:81018291-81018313 TAGAATATGGAAAAGGTGATGGG + Intronic
1099712337 12:86243462-86243484 TAGAATAAGGCAAAGGTGATGGG + Intronic
1099728723 12:86469312-86469334 CAGAATATGGCAAAAGTGATAGG + Intronic
1100385170 12:94099448-94099470 CATAATCAGGAACATGAGAGAGG + Intergenic
1100491078 12:95078644-95078666 CAGAAAAAGGGAAAAGAGATTGG + Exonic
1100546454 12:95607688-95607710 ACGAATAAGGAACATGACATTGG - Intergenic
1100976537 12:100128443-100128465 CATAGTAAAGAAAATGAAATAGG + Intronic
1101127795 12:101655795-101655817 CAGAAAAAGGAAAATAATATAGG + Intronic
1101446451 12:104740201-104740223 CAGAATAGGGAACGTGGGATAGG - Intronic
1101548578 12:105740269-105740291 AAGAATAATGCAAATGCGATTGG + Intergenic
1101571458 12:105957655-105957677 CTAAATAAGGAAAAACAGATTGG + Intergenic
1101615546 12:106333158-106333180 CAAAATCAGGAAACTGACATGGG - Intronic
1101662787 12:106780897-106780919 AAAAATAAGGAAAATTTGATAGG + Intronic
1101867952 12:108536582-108536604 CAGAATTAGTAAAATTAGAAAGG + Intronic
1102779275 12:115549702-115549724 CAGAATATGGCAAAAGTGATGGG + Intergenic
1103066209 12:117899713-117899735 TAGAATATGGCAAAGGAGATGGG + Intronic
1103399757 12:120635711-120635733 CTGAATGTGGAAAATGAGAATGG - Intergenic
1103578984 12:121900152-121900174 CTGAATGATGAAAATGAGAATGG + Intronic
1104091474 12:125521320-125521342 TGGAATAAGGAAAAGGAGAAGGG - Intronic
1106650323 13:31683419-31683441 CATAATGGGGAAAATGAAATTGG - Intergenic
1106775881 13:33009122-33009144 AAGGTTAAGGAAAATGAGAATGG - Intergenic
1106846493 13:33743146-33743168 CTGGACAAAGAAAATGAGATGGG + Intergenic
1106872782 13:34039637-34039659 AAGAAGAAGGAAAAAGAGAAGGG - Intergenic
1107250543 13:38355343-38355365 AAGAATAAGTAAAATGAGATGGG + Intronic
1107634761 13:42381064-42381086 CAGAATGAGTAAACTGAGGTAGG - Intergenic
1107951625 13:45467025-45467047 TAATATAAGGAAAATCAGATAGG + Intronic
1108037913 13:46311456-46311478 CAAAATCAGGAAATTGACATTGG + Intergenic
1108149582 13:47519468-47519490 CAGAAGAAGTCAAATGAGAATGG - Intergenic
1108806360 13:54161652-54161674 CATAATAAGAAAAATGAGCCAGG + Intergenic
1109011361 13:56949895-56949917 GAGAAGAAGGAAAATGCCATTGG + Intergenic
1109714774 13:66207032-66207054 TAGAATATGGCAAATGTGATGGG + Intergenic
1109835646 13:67852748-67852770 CAAAATAAGGAAAAAAAGACTGG + Intergenic
1110057183 13:70987377-70987399 GAGAATATAGAAAATGTGATTGG + Intergenic
1110075190 13:71231651-71231673 CATAATAAAGAAAATGGGAACGG + Intergenic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1111112209 13:83728170-83728192 CAGAAAATGCAAAATGAAATAGG - Intergenic
1111278731 13:85989711-85989733 AAGAATAAAGAAAATGAACTTGG - Intergenic
1111508318 13:89225690-89225712 TAGAATGAGGAAAATCAAATAGG + Intergenic
1111738936 13:92177378-92177400 TGAAATAAGGAAAGTGAGATGGG - Intronic
1113540858 13:111108101-111108123 CAAAATAAGGAAATTGATGTGGG - Intergenic
1114995605 14:28348109-28348131 CAGCATAAGCAAAATGAGTGTGG - Intergenic
1115295963 14:31827191-31827213 CAAAATAATTAAAATTAGATGGG + Intronic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117984023 14:61369555-61369577 CAGAATGGGGAAAATGAAATAGG - Intronic
1118102299 14:62620466-62620488 CTGTACATGGAAAATGAGATAGG + Intergenic
1118497108 14:66317776-66317798 CAGAAGAAAGAACTTGAGATAGG + Intergenic
1118637694 14:67762890-67762912 CAGAAAAAAGAAAATGGAATAGG - Intronic
1118891486 14:69913345-69913367 CAAAATAAGCAAAATATGATTGG + Intronic
1119856660 14:77906165-77906187 CAGAATTAGGAACAGGAAATAGG + Intronic
1120284829 14:82486565-82486587 CATTGTAAGGAAAATGGGATGGG - Intergenic
1120550085 14:85859664-85859686 CAAAATAAAGAAAGGGAGATGGG + Intergenic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1120633704 14:86925267-86925289 CAGATAAAGAAAAATGAGAAGGG - Intergenic
1120953699 14:90063391-90063413 CAGCAGAAGGAAAATGATTTGGG + Intronic
1121298472 14:92849925-92849947 CAGAATATGGCAAATGTGAGGGG + Intergenic
1121476400 14:94210749-94210771 AAGAATAAGGCAAATGAGAAGGG + Intronic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121821710 14:96973928-96973950 CACAAAAAGGAAAATTATATGGG - Intergenic
1122200420 14:100119241-100119263 CAAAATAAAGAGGATGAGATAGG - Intronic
1124842190 15:33252727-33252749 CAAAACCAGGAAATTGAGATTGG + Intergenic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1126371004 15:47947070-47947092 AAAAATAAGGAAAAGGAGAAAGG + Intergenic
1126554787 15:49973956-49973978 CAGAATAGGAAAAATAAAATAGG - Intronic
1126908526 15:53393937-53393959 GAGAATGAGGAAAATTAGAAAGG - Intergenic
1127074332 15:55311017-55311039 CAGAATCAGGATATGGAGATTGG - Intronic
1127222166 15:56891292-56891314 CAGAAGAGGGAAAAAGAGACTGG - Intronic
1127720880 15:61698121-61698143 CAAAATGAAGAAAATGAGACTGG + Intergenic
1127755223 15:62085628-62085650 CAGAATAAAGAAAATAAGTTAGG + Intergenic
1127842767 15:62845294-62845316 AAGAACAACAAAAATGAGATTGG + Intergenic
1128131706 15:65232168-65232190 AAGAATAGGGAAATTAAGATAGG + Intergenic
1129095587 15:73203957-73203979 AAGCAGAAGGAAAATGATATAGG - Intronic
1129819703 15:78590517-78590539 CAGAAAGAGGAAACTGAGAGTGG + Exonic
1130328119 15:82897560-82897582 CAGAATATGGCAAAGGTGATGGG + Intronic
1130329057 15:82905823-82905845 AGAAAGAAGGAAAATGAGATAGG + Intronic
1131021731 15:89104749-89104771 CAGAAGGAGGAAATGGAGATGGG - Intronic
1131045780 15:89314270-89314292 CAGAACAAGGAAATAGAGCTAGG + Intronic
1133689175 16:8196548-8196570 AAGGATAAGGGAAATGAAATGGG + Intergenic
1133812170 16:9169096-9169118 TAGAAGAAGAGAAATGAGATGGG - Intergenic
1133901554 16:9980110-9980132 CAGAAAAAGAAAAATTAGCTGGG + Intronic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1135315892 16:21444083-21444105 AAGAAAAAGAAAAATTAGATGGG - Intronic
1135368818 16:21876344-21876366 AAGAAAAAGAAAAATTAGATGGG - Intronic
1135442999 16:22494798-22494820 AAGAAAAAGAAAAATTAGATGGG + Intronic
1136009137 16:27351353-27351375 CAGAATATGGTAAAGGTGATGGG - Intronic
1136326002 16:29524566-29524588 AAGAAAAAGAAAAATTAGATGGG - Intergenic
1136440691 16:30264550-30264572 AAGAAAAAGAAAAATTAGATGGG - Intergenic
1137377251 16:47962801-47962823 TAGAACAAGAAAAATGAGACTGG + Intergenic
1137889478 16:52143710-52143732 TAAAATAAGGAAAATGGGTTTGG + Intergenic
1138044282 16:53704456-53704478 CAGAAGAAGGACAAGGAAATGGG - Intronic
1138253734 16:55532269-55532291 CATTATAATGATAATGAGATAGG - Intronic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138826659 16:60329026-60329048 CTGAATAAGGAAAATCACAATGG - Intergenic
1139151725 16:64389665-64389687 CAAAACAAGGAAATTGATATTGG + Intergenic
1139232192 16:65294432-65294454 CAGAAAACGGAAAAGGAGAGTGG + Intergenic
1140903562 16:79392006-79392028 CAGAGTAAGGAAAGAGAGAGAGG + Intergenic
1140928546 16:79606073-79606095 CAGAAAAAGGGAACTGATATGGG + Intergenic
1141351278 16:83300038-83300060 CAGAATATGGCAAAAGTGATGGG - Intronic
1143069778 17:4281385-4281407 CAGAGTTAGGAATATGAGAAAGG + Intronic
1144146308 17:12402002-12402024 CGAAATAAGGAAAATGAAATAGG + Intergenic
1145855812 17:28156233-28156255 AAGAATAGAGGAAATGAGATTGG - Intronic
1146115233 17:30131083-30131105 CAGGATAAGGAAAATTAAACAGG + Intronic
1146244289 17:31265534-31265556 CAGAGTAAGCAATATGAAATGGG - Intronic
1146407130 17:32548477-32548499 CAGAGGAGGGAAAATGAGAAGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149022678 17:51987877-51987899 CAGAAGAAGGTAAATAATATAGG + Intronic
1149827268 17:59840476-59840498 CAGTATAAGGAAAATCTGGTTGG + Exonic
1151856285 17:76724520-76724542 CAAAATAAGAAAAATCAGCTGGG + Intronic
1152510486 17:80783678-80783700 CAGAACAAGGCAGATGGGATTGG + Intronic
1152979603 18:263917-263939 AAGAATAAACAAAATCAGATAGG + Intronic
1153290988 18:3501355-3501377 CAGATTAAAGAAAACTAGATTGG + Intronic
1153639304 18:7141784-7141806 CAGAATAAGAAATGTGAGCTGGG - Intergenic
1153687117 18:7557486-7557508 AAGAATAAAGGAAATGAGCTGGG - Intergenic
1154088647 18:11334981-11335003 CAGAAAAAGGAAAATGATATAGG - Intergenic
1155004955 18:21720429-21720451 CAGAATATGGAAAATTCTATAGG + Intronic
1155788606 18:29934142-29934164 CAGAAAAAGGAAAATAAGACAGG + Intergenic
1156056167 18:33006650-33006672 TAGAATATGGAAAAAGTGATGGG + Intronic
1156183770 18:34637830-34637852 CAGAATAAGGCCAATTAGCTGGG + Intronic
1156274330 18:35568498-35568520 CAAAATGAGGAAATTGATATTGG - Intergenic
1156291044 18:35748731-35748753 AAGAAAGAGGAAAAGGAGATGGG - Intergenic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1156810661 18:41246046-41246068 TAGATTATGGAAAATAAGATAGG - Intergenic
1157234863 18:45954912-45954934 GAGTATAAGAAAAATTAGATTGG + Exonic
1158010875 18:52725760-52725782 CTGGATAAGGCAATTGAGATAGG + Intronic
1158146962 18:54325155-54325177 CAGGATAAGGGAAATGAGGGAGG - Intronic
1158816286 18:61100976-61100998 CAGAATAAGGCATATGAGGAAGG + Intergenic
1158876418 18:61738605-61738627 CAGCAAAAGGATACTGAGATAGG + Intergenic
1159116191 18:64115423-64115445 AAGAAGGAGGAAAATGAGGTAGG + Intergenic
1159186970 18:64987581-64987603 CAGAAGAAGTAAAATAACATAGG - Intergenic
1160220635 18:76974934-76974956 CAAAATAATGAAAATTAGCTGGG - Intergenic
1161128088 19:2571386-2571408 CAGAACAAGGATAAGGATATAGG - Intronic
1161150973 19:2709207-2709229 AAGAAAAAAGAAAATTAGATGGG + Intergenic
1161506549 19:4647083-4647105 ATGAATAAACAAAATGAGATCGG - Intronic
1162234555 19:9297719-9297741 AAGAACAAGGAAAATGCGAGAGG + Intronic
1163531333 19:17850819-17850841 GAGAATAAGTAAGAGGAGATTGG + Intergenic
1164768808 19:30792306-30792328 CAAAATAAAGAAAATGTCATGGG - Intergenic
1165047073 19:33113577-33113599 CATAATAAGGAAAATCTCATGGG + Intronic
1165750110 19:38254294-38254316 AAGAAAAAAGAAAAAGAGATGGG - Intronic
1166027027 19:40095935-40095957 CAAAATCAGGAAAATGATATAGG + Intergenic
1167406122 19:49309919-49309941 AAGAAGAAGGAAAAAGAAATGGG - Intronic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
925124872 2:1446936-1446958 CAGAAAACATAAAATGAGATGGG - Intronic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
926635923 2:15179738-15179760 CAGAAAAATGAAAATGTGTTTGG + Intronic
926812381 2:16766943-16766965 CAGAATAAGGCAAATGTAATGGG + Intergenic
926864434 2:17342375-17342397 CAGAATAAGAACATGGAGATCGG + Intergenic
927235071 2:20865886-20865908 GAGAATAACAAATATGAGATGGG + Intergenic
927799205 2:26081599-26081621 CAGAAACAGGAAAATAACATTGG - Intronic
927893484 2:26766800-26766822 CTGTATAAGGAAACTGAGGTAGG + Intronic
928070825 2:28214077-28214099 CAGAATCAGGAAATTGACATTGG + Intronic
928203164 2:29264315-29264337 CAGAATCAGGAAAATGCTACTGG - Intronic
928476414 2:31631856-31631878 CAGAATCAGAACAAGGAGATTGG + Intergenic
928530602 2:32187018-32187040 AAGAAAAAGAAAAATGAGTTCGG + Intronic
928670751 2:33600656-33600678 CAAAATAAGGAAACTGAAAAAGG - Intergenic
929117685 2:38457905-38457927 GAGAATGAGGAAAATGTGAGAGG - Intergenic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930450305 2:51527533-51527555 CAGCATGAGAAAAATTAGATTGG - Intergenic
930759035 2:55011733-55011755 TAAAATTAGGAAAATGAGAGGGG + Intronic
931967897 2:67553724-67553746 CACAATAAGGCAAAAGTGATAGG + Intergenic
932985025 2:76715733-76715755 CAGAATAAGAAACATGAGAACGG + Intergenic
932989773 2:76772373-76772395 CAGACTAAGAAAAATTAAATGGG + Intronic
933168377 2:79098441-79098463 TAGAATGAGGAAAAAGAGAGAGG + Intergenic
933204474 2:79489656-79489678 TAGAATAAGCAAAATGAGCCAGG - Intronic
933214558 2:79614508-79614530 AAGAATTATGAAAATGAAATAGG + Intronic
933736465 2:85499251-85499273 CAGGAAAAGGAAAATGGGCTGGG - Intergenic
933903594 2:86867369-86867391 TAGAAGGAAGAAAATGAGATGGG + Intergenic
934605416 2:95691516-95691538 GACAATAAGAAATATGAGATAGG + Intergenic
934962429 2:98688442-98688464 CAGAATATGGCAAAGGTGATAGG + Intronic
934963381 2:98697525-98697547 CAAAATCAGGAAATTGACATTGG - Intronic
935776920 2:106481596-106481618 TAGAAGGAAGAAAATGAGATGGG - Intergenic
935829405 2:106985007-106985029 TAGAACAAGCAAAATGACATGGG + Intergenic
936032027 2:109080102-109080124 CAGAGGAGGGAAAAGGAGATGGG + Intergenic
936145766 2:109979858-109979880 CAGAATATGGCAAAAGTGATGGG + Intergenic
936198923 2:110391620-110391642 CAGAATATGGCAAAAGTGATGGG - Intergenic
936538876 2:113334061-113334083 GACAATAAGAAATATGAGATAGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936948777 2:117956107-117956129 CTGGATGAGGAAAATGAGGTAGG - Intronic
936959418 2:118057671-118057693 CAGAGTATGGAACATGAAATTGG + Intergenic
937404619 2:121615382-121615404 CAGCATAAGTAAAATGAGGGAGG + Intronic
937943741 2:127311878-127311900 AAGAAAAAAGAAAAGGAGATTGG - Intronic
938057593 2:128228356-128228378 CAGAGAAAGGAAAAAGAGAGAGG + Intergenic
938264360 2:129915798-129915820 CAGAACAAGAAAACTGAGAAGGG + Intergenic
938465933 2:131525245-131525267 AAAAAGAAGGAAAATGATATAGG - Intergenic
938707358 2:133944141-133944163 CAGAATATGGCAAAAGTGATGGG - Intergenic
938813837 2:134879275-134879297 GAGAATGGGGAAAATGTGATTGG - Intronic
939106833 2:137958677-137958699 CAGAAGAAGAAAAATGAAAAAGG + Intergenic
939260267 2:139798982-139799004 AAGAATAATAAAAATTAGATTGG + Intergenic
939266982 2:139886553-139886575 GGGAATAAGGAAAATGTGAAAGG - Intergenic
939683170 2:145164065-145164087 TCGAAAAAGGAAAATGAGACTGG - Intergenic
940054007 2:149494231-149494253 CTAAATAAGGAAATGGAGATGGG - Intergenic
940072186 2:149701266-149701288 CAGTAAATGGAAAATGAGAAAGG - Intergenic
940643070 2:156367442-156367464 AAGAATAAAGAAAATTAGAAGGG + Intergenic
941497000 2:166218091-166218113 ATGAATAAAGAAAATGTGATAGG + Intronic
941798086 2:169623663-169623685 CAGAATAAGGACACTGAAATGGG - Intronic
942159960 2:173173565-173173587 CAAGTTAAGGGAAATGAGATTGG - Intronic
942588924 2:177519361-177519383 AAGAATAAGAAAATTGGGATAGG - Intronic
942924871 2:181419647-181419669 CAGAATAAGGAAGTTGAAAAGGG + Intergenic
943557038 2:189418836-189418858 CTGAGTATGGAAAATGAGAGAGG + Intergenic
943696449 2:190940492-190940514 CAGAATAAGGGCATTCAGATAGG - Intronic
943812850 2:192211154-192211176 TAGAATAAGGTAAATGATATAGG - Intergenic
943854897 2:192777064-192777086 AAGTATGAGGAGAATGAGATGGG - Intergenic
944566351 2:200995444-200995466 CAGAATAAGGCAAAGGTGATGGG + Intronic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
946532366 2:220585255-220585277 GAGAAAAATGATAATGAGATGGG + Intergenic
946678809 2:222191614-222191636 AAGAAAAAGGAAAATAAGTTAGG + Intergenic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947539484 2:230965398-230965420 CAGAACAAGGAAAATTATAAGGG + Intergenic
947544617 2:231002022-231002044 CAGAATCAGGAAAGTGAGCAGGG + Intronic
947907917 2:233779188-233779210 CAGAATATGGCAAAGGTGATGGG - Intronic
948108577 2:235435439-235435461 CAGAATATGGCAAAGGTGATGGG + Intergenic
948157653 2:235797235-235797257 GAGAATAACTTAAATGAGATAGG + Intronic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1169654051 20:7903002-7903024 CTGAAAAAGGAAAATGAAAGAGG + Intronic
1169707546 20:8522573-8522595 CAAATTAAGGAAAATGAGTTTGG + Intronic
1169850927 20:10049809-10049831 AAGAAAAAGGAAAAAGGGATGGG + Exonic
1169874249 20:10279378-10279400 CAAAAAAAGAAAAATGGGATTGG - Intronic
1169884248 20:10381134-10381156 CAGAAAAATTAAAATGAGCTGGG + Intergenic
1169944219 20:10971755-10971777 CAGAATATGGCAAAGGTGATAGG - Intergenic
1170907195 20:20527244-20527266 CAGAATAAGGAAGAAGATAAGGG + Intronic
1171121604 20:22573265-22573287 CAGAATCTGGAAAATGAGTAGGG - Intergenic
1171242811 20:23585651-23585673 CAGAGTCAGGAAACTCAGATTGG - Intergenic
1171244938 20:23603394-23603416 CAGAATCAGGAAACTCAGATTGG + Exonic
1172158643 20:32848649-32848671 CTGAAATAGGAAAATGAGAGGGG - Intronic
1172311632 20:33922721-33922743 CAGAATTAGGAAAACCAGTTAGG + Intergenic
1172419866 20:34807055-34807077 CGGACTATGGAAAATGTGATAGG + Intronic
1173343364 20:42175262-42175284 CAAGATGAGGCAAATGAGATTGG - Intronic
1173705094 20:45104218-45104240 CAGAATATGGCAAAAGTGATGGG + Intergenic
1173955559 20:47029742-47029764 TAGAAAAAAGAAAAAGAGATGGG - Intronic
1173957959 20:47049261-47049283 CAGAACTAGAAAAATGACATAGG + Intronic
1174148014 20:48465700-48465722 TAGAATATGGAAAATCAAATGGG - Intergenic
1174202841 20:48819249-48819271 GAGAGTAAGGGAGATGAGATTGG - Intronic
1174415827 20:50366251-50366273 AAAAATAAGGAAAATTAGACAGG - Intergenic
1174523688 20:51154823-51154845 CAGAAGAAGGAATGTGAGCTAGG - Intergenic
1174723880 20:52841045-52841067 AAGAATAAGGAAGAGGAGAGGGG - Intergenic
1175023085 20:55872383-55872405 CAGAATGAGGGAGATCAGATAGG + Intergenic
1176893646 21:14349936-14349958 CAGAAAATGGAAAATGACCTAGG - Intergenic
1178728939 21:35081182-35081204 CAGAGTTAGGATAATGAGAGGGG + Intronic
1179125454 21:38586793-38586815 AAGAAAATGGAAAATGAAATCGG + Intronic
1179364714 21:40747315-40747337 TAGACTAAGGAAAAAGAGAAAGG + Intronic
1179768476 21:43594249-43594271 CAGAAAAAGGAAAATGACGTTGG + Intronic
1181186207 22:21106330-21106352 GAGCTTAAAGAAAATGAGATCGG - Intergenic
1181619346 22:24077857-24077879 CAGATTAAGAAAAATGAAATAGG - Intronic
1182074978 22:27489290-27489312 CAGAATCAGGAAATTGACACTGG - Intergenic
1182113397 22:27740503-27740525 CAGAATATGGCAAAGGTGATGGG + Intergenic
1182691199 22:32164641-32164663 CAGAGTCAGGAAATTGACATTGG - Intergenic
1182783506 22:32886960-32886982 CTGAATACGGCAAAGGAGATGGG + Intronic
1183767217 22:39889381-39889403 CAAAATAATGAAAAAGAGAAAGG - Intronic
1185007872 22:48294870-48294892 CAGAACAAGAAAAATGATACGGG + Intergenic
1185309773 22:50147800-50147822 CAGAAATAGGGACATGAGATGGG + Intronic
949706186 3:6820134-6820156 AACACTAAGGAAAATGAGGTGGG - Intronic
950624149 3:14231944-14231966 GCGAATATAGAAAATGAGATGGG - Intergenic
951618554 3:24575667-24575689 CAGGAAAAGAAAAAGGAGATTGG + Intergenic
951944437 3:28118891-28118913 CAAAATCAGGAAACTGACATTGG - Intergenic
951991493 3:28680092-28680114 CAGAGTCAAGAAAATGAGAGAGG + Intergenic
952077726 3:29718414-29718436 AGGAATAGGGAAAATAAGATAGG + Intronic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
952223324 3:31347276-31347298 CAGAATCATGAAAATGGGAATGG - Intergenic
953184341 3:40624405-40624427 CACAATAAAGAAAAAGAGATGGG + Intergenic
953231082 3:41065577-41065599 GAGAACAAGGAAAACAAGATGGG - Intergenic
953501555 3:43440043-43440065 CACAAAAAAGAAAATGAGAAAGG + Intronic
953642177 3:44718944-44718966 CAGAATCAGGAAAACCAGGTAGG + Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955168519 3:56539748-56539770 CTGATTAAGGTAAAAGAGATAGG - Intergenic
955422686 3:58754628-58754650 AAGAATAAGGTAAATGATAACGG - Intronic
955437024 3:58912084-58912106 CAGAATAAAGAATATGGGAGGGG - Intronic
955498388 3:59560485-59560507 CAGAATATGGCAAAGGTGATAGG - Intergenic
955718529 3:61857052-61857074 CAGAAATAGGAAAATAGGATGGG - Intronic
956168123 3:66411861-66411883 CAGAAAAACGAAAAAGAGAAAGG + Intronic
956530409 3:70211724-70211746 AAGAAAAAGGAAAAAGAGAAAGG - Intergenic
956978289 3:74607969-74607991 CAGAACCAGGAAATTGACATTGG - Intergenic
957115892 3:76025991-76026013 CAGAATAAATACAGTGAGATTGG - Intronic
957155635 3:76540667-76540689 GAGAATAAGGCAAATGACAAGGG - Intronic
957232229 3:77535008-77535030 CAGAATGGGGAATATGTGATTGG - Intronic
957268373 3:77997166-77997188 AAGAAAAAGGAAAGTGAGCTAGG - Intergenic
957744779 3:84325349-84325371 CAGAAATAGGAAAATGATACAGG + Intergenic
957816087 3:85299103-85299125 CACAATAAAGCAAAAGAGATAGG - Intronic
958502567 3:94933398-94933420 CAAAATAACTAAAATGAAATAGG - Intergenic
958594810 3:96209024-96209046 CAGAATATGGGAAAAGAGAAGGG + Intergenic
959105008 3:102055806-102055828 CAGCATAAGGAAAGTTAGAGAGG - Intergenic
959341222 3:105134450-105134472 CAGAAGAAAGAAAAAGGGATGGG + Intergenic
959486074 3:106928076-106928098 GAGAATCAGCAAAGTGAGATAGG + Intergenic
959565035 3:107825500-107825522 CAAATTAGGGCAAATGAGATGGG - Intergenic
960016191 3:112890769-112890791 CAGAAGAAGTAAAATGAAATTGG - Intergenic
960077976 3:113510138-113510160 CCAAATAAGAAAAATGAGACTGG + Intronic
960107610 3:113814835-113814857 CTTAAGAAGGAAAATGTGATTGG + Intergenic
960330386 3:116352477-116352499 CAGTATAAAGTAAATGAGGTTGG - Intronic
960447049 3:117762049-117762071 CATAATGAGGAAAGGGAGATAGG - Intergenic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
960827267 3:121802673-121802695 CAGAAGAAAGAAAATGATAAAGG - Intronic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961773381 3:129266643-129266665 CAGAATAATAAAAATGAGAAAGG - Intronic
962123390 3:132588112-132588134 CAAAATTTGGAAAGTGAGATGGG - Intronic
962908432 3:139825888-139825910 CAGCATGTGGAAACTGAGATGGG + Intergenic
963213474 3:142719858-142719880 CAGAAGAAAGGAAATAAGATCGG + Intergenic
963609370 3:147445993-147446015 TAGAATCAGTAAAATGAAATTGG - Intronic
963636959 3:147810283-147810305 CAGAATAAGGAAATATAAATGGG - Intergenic
964102389 3:153002659-153002681 AAGAATAAGGAAAGTCATATGGG - Intergenic
964404723 3:156337447-156337469 AAGAAGAAGGAAAATGAAAAGGG - Intronic
964413501 3:156423812-156423834 CAGAGTCAGGAAAATGAGCCAGG + Intronic
964493281 3:157260151-157260173 CAGAATATGGCAAAAGTGATGGG - Exonic
964521333 3:157572316-157572338 CAGAAAAAGGAAAGAGAGATTGG + Intronic
964930005 3:162007110-162007132 CAAAAGAAGGAAAAAGAAATGGG - Intergenic
965329444 3:167352244-167352266 TAGATTAAGAAAAATGAGAGAGG + Intronic
965478640 3:169188713-169188735 CAGAGTTGGTAAAATGAGATTGG - Intronic
965906455 3:173713221-173713243 AAGAATAAAGAAAAGGAGTTAGG + Intronic
966228404 3:177623312-177623334 CAGAAGAAAGGAAAAGAGATGGG + Intergenic
966480181 3:180399328-180399350 CAGAAGAAGGAAAGTGTCATTGG + Intergenic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
967273626 3:187751801-187751823 CAAAATCAGGAACATCAGATTGG - Intergenic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
968015180 3:195324281-195324303 CAGAATAGAGAAACTGAAATGGG + Intronic
968808603 4:2790166-2790188 CAGAATAAGGCCAAAGAGAAGGG - Intergenic
969942574 4:10749068-10749090 CTGGGTAAGGAAAATGAGATAGG + Intergenic
970064656 4:12078866-12078888 AATAAAAAGGAAAATGAAATAGG - Intergenic
970557120 4:17245342-17245364 CAGAAGCAGGAAGATGAGGTGGG + Intergenic
970593838 4:17581984-17582006 CAGATTGAGGAATATAAGATAGG - Intronic
970899127 4:21138305-21138327 TACAATAAGAAAAATAAGATGGG - Intronic
971109578 4:23569721-23569743 CAGAATAAGCAAAATTAAAATGG - Intergenic
971484358 4:27144124-27144146 AGAAATAAGGAAAATAAGATTGG - Intergenic
971728764 4:30349178-30349200 CAGAGAAAGGAAAGTGACATAGG - Intergenic
971818116 4:31516279-31516301 AAGGATAAGAAAAATAAGATAGG + Intergenic
972435260 4:39027717-39027739 AAGAAAAAGGAAAATTAGCTGGG - Intronic
973008063 4:45037949-45037971 GAGAATAAGGAAAAAGAGATGGG - Intergenic
973661776 4:53115067-53115089 CAGAAGAATGAAAATTAGAAGGG + Intronic
973813824 4:54599663-54599685 CAAAATATGGTAAATGAGAGTGG - Intergenic
974265061 4:59576435-59576457 AGGAATAAGGAAATTGACATAGG + Intergenic
974306187 4:60143421-60143443 CACAATAAGGAAATTGAGTGTGG + Intergenic
974515245 4:62899414-62899436 AAGCATAATGAAAATGAGAGTGG + Intergenic
974525564 4:63046110-63046132 CAGAAAAAGTAGAAAGAGATGGG - Intergenic
974661631 4:64897776-64897798 CAGAATAATTAAACTGAGATTGG + Intergenic
974895905 4:67938605-67938627 CAGAAGCAGAAAAATGAAATTGG - Intronic
974986811 4:69037533-69037555 CTGAATAAAGAAAATGGAATGGG - Intronic
975201202 4:71592016-71592038 CAGGGTAAGGAACCTGAGATTGG + Intergenic
975653196 4:76614886-76614908 CTGAATAAGGCATTTGAGATGGG + Intronic
976211213 4:82672307-82672329 CAGACTAAGAAAAAAGAGGTAGG + Intronic
976318926 4:83689164-83689186 CAGAACAAGTAAAGTGACATTGG + Intergenic
976392222 4:84517475-84517497 TAGAATAAGGATAAAGAGAGGGG - Intergenic
977411085 4:96664941-96664963 CAAAATTAGGAAACTGACATGGG - Intergenic
977795317 4:101157573-101157595 TAGTACAAGGAAAATGAGACTGG + Intronic
978151918 4:105446515-105446537 CAGAAGGAAGAAAAGGAGATGGG + Intronic
978159440 4:105528260-105528282 AAGAATAAGAAAAGTGACATAGG - Intergenic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978311403 4:107388126-107388148 GAGAAAAAGGAAAATGGGGTTGG - Intergenic
978480518 4:109184933-109184955 CAGAATCAGGATCAAGAGATGGG - Intronic
978976588 4:114882663-114882685 CAGAATAGGAAAAAAGAGAGTGG + Intronic
979047875 4:115893204-115893226 CAAACTAAGGAATATGAGATTGG + Intergenic
979513753 4:121583345-121583367 CAGAATCAGGGAAAGGAAATCGG - Intergenic
979633206 4:122926560-122926582 CAGAATAATGTAAATCATATGGG + Intronic
979646228 4:123073214-123073236 AAGAAGAAAGAAAAGGAGATAGG - Intronic
979897751 4:126181092-126181114 GAGAATGAGGAAGATGAGACTGG - Intergenic
979929534 4:126613814-126613836 AAGAATAAGGATAATAAAATTGG - Intergenic
980733595 4:136853192-136853214 CAAAATAAGGAATATGAAAGTGG - Intergenic
981265398 4:142777241-142777263 CAGAATATGGCAAAGGTGATAGG + Intronic
981749731 4:148082177-148082199 CAGAGTAGGGAAAATGAGCTAGG - Intronic
981838853 4:149087793-149087815 AAGAATAAGGAAGATGATGTGGG - Intergenic
981936695 4:150247060-150247082 AAGAAGAAGGGAAAGGAGATCGG + Intronic
982005813 4:151061865-151061887 AAGAAAAAAGAAAATGAGCTGGG - Intergenic
982045713 4:151443553-151443575 CATAATAAGGAAAGAAAGATGGG + Intronic
982306846 4:153941515-153941537 CAAACTAAGGATAATGAGAATGG - Intergenic
982464146 4:155709354-155709376 CATCAAAAGGAAAAAGAGATAGG - Intronic
982608632 4:157545583-157545605 CAAAATATGTAAATTGAGATAGG - Intergenic
982669986 4:158308832-158308854 CAGAATAAACAAAATAACATGGG - Intergenic
982988260 4:162237949-162237971 ACCAATAAGGAACATGAGATTGG - Intergenic
983168083 4:164502632-164502654 AAGAATAAAGAAAGTGAGAGAGG - Intergenic
983186653 4:164708153-164708175 CTGAATAGGGAAAAAGAGATAGG - Intergenic
983307950 4:166017865-166017887 CAGGATAAGGACAATGATATTGG + Intronic
983667048 4:170194085-170194107 CAGAATCAGAACAAGGAGATTGG - Intergenic
984257432 4:177405312-177405334 CAGAAAAAGGAAAATCTGAAGGG - Intergenic
984908459 4:184650256-184650278 CATCATGAGGAAAAAGAGATGGG + Intronic
985338968 4:188927407-188927429 CATCAAAAGGAAAAAGAGATAGG - Intergenic
985630545 5:1011710-1011732 CAAAATAACACAAATGAGATTGG + Intronic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986514833 5:8550438-8550460 CAGGATATGAAAAATGAGATGGG - Intergenic
986829826 5:11563906-11563928 CAGAAGTAGGAACATGAGTTTGG - Intronic
986876732 5:12120268-12120290 AAAAATAAGGAAATTGAGAATGG - Intergenic
986882988 5:12198401-12198423 TAGAATAAGGAAAGTGAAACAGG - Intergenic
987272727 5:16328918-16328940 CAGAGGAAGGAAAATTATATTGG + Intergenic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987764076 5:22202350-22202372 AACAATAAGGAGAAAGAGATAGG + Intronic
988284551 5:29194498-29194520 CAGAAAAAGGGAGATGAGAAGGG - Intergenic
988411163 5:30887645-30887667 CCAAAGAATGAAAATGAGATAGG - Intergenic
988679465 5:33470864-33470886 CAGAATAAGGACAGTCAGAGTGG - Intergenic
989065061 5:37452062-37452084 CAAAATAAAGAGAATGAAATTGG - Intronic
989490032 5:42039676-42039698 AAGAATATGGCAAAAGAGATGGG + Intergenic
989744861 5:44816753-44816775 CAGAAGAACGCAAATCAGATTGG - Intronic
990312839 5:54555846-54555868 AAGAATAAAGAAAAAAAGATTGG + Intergenic
990433344 5:55760424-55760446 CAGAAAAAAGAAAATGAACTTGG - Intronic
990534164 5:56703837-56703859 TAGAAGATGGAAAAAGAGATGGG - Intergenic
990740342 5:58906200-58906222 CAGAATACAGAAAAAGTGATGGG + Intergenic
990778564 5:59331985-59332007 CAGAGAAAGGTAAATGAAATAGG - Intronic
991183261 5:63778956-63778978 CAGAAAACGGAAAAAGAGAATGG + Intergenic
991187600 5:63828431-63828453 CAAAAGAATGAAAATGACATGGG + Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
991898803 5:71435434-71435456 AACAATAAGGAGAAAGAGATAGG + Intergenic
992010827 5:72525727-72525749 CAGAATATGGCAAAAGTGATAGG + Intergenic
992296045 5:75327806-75327828 CAGAATAAGGATAAAAAGAAAGG - Intergenic
992930943 5:81644431-81644453 CAGAAAAGGAAAAATGAGAGAGG + Intronic
993218457 5:85057920-85057942 GAGAATAAGAAACATGAGCTGGG + Intergenic
993892363 5:93489938-93489960 CTGAAAAAGGAAAATGAAAGAGG + Intergenic
993954791 5:94218898-94218920 CTGAATAAGGTAAATGTCATAGG - Intronic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
995119866 5:108524557-108524579 CATTATAAGAAAAATGAGTTTGG - Intergenic
995244777 5:109923121-109923143 TACCATAAGGAAAATGAGGTGGG - Intergenic
995899765 5:117052048-117052070 CAGAAGAAGGAAATTGACAGGGG + Intergenic
996363828 5:122678847-122678869 CAGAAAATGGAAAATTAGCTGGG + Intergenic
997502277 5:134385711-134385733 AAGGATAAAGAAAATAAGATAGG + Intronic
998036009 5:138916681-138916703 AACAATAAAGAAAATGAGCTGGG - Intronic
998087312 5:139336964-139336986 CAAAATCAGGAAAATGAACTAGG - Intergenic
998293720 5:140944024-140944046 CAAAATATGGAAAACCAGATTGG + Intronic
999059740 5:148620657-148620679 AAAAATAAGCAAAAAGAGATGGG - Intronic
999360064 5:150976695-150976717 CAGAATTAAGAAAGTGAGAAGGG + Intergenic
999555700 5:152739777-152739799 CAAAATCAGGAAAATGATTTAGG + Intergenic
1000267494 5:159651683-159651705 GAGAATATAGAAAATGAGACAGG - Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1001136785 5:169109052-169109074 CAGCATATGGAAAAGGGGATGGG + Intronic
1001148495 5:169205340-169205362 CAGAATAAGGAGAATAGAATAGG - Intronic
1001291684 5:170467560-170467582 TAGAATGAGGAAGATGACATTGG + Intronic
1001637746 5:173224495-173224517 AGAAATAAGGAAAATGAGGTGGG - Intergenic
1002156658 5:177286919-177286941 CAGGATGGGGAAAATGAGACAGG + Intronic
1003334982 6:5162292-5162314 AAAAATAAGGTAAATGAAATGGG - Intronic
1003540691 6:7015838-7015860 CAGATTAATGAAAATCAGCTAGG + Intergenic
1003650967 6:7959800-7959822 CAATATAAGAAAAATGAGCTGGG + Intronic
1003796724 6:9613390-9613412 CAGAATAAAAGAAATGAGATGGG + Intronic
1003806340 6:9729459-9729481 ATGAATCAGGATAATGAGATAGG + Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004299046 6:14440611-14440633 CAGAATCTGGAAAATGATTTGGG - Intergenic
1004514553 6:16311321-16311343 CAGAAAAAAGAAAATGGGTTTGG - Intronic
1004929488 6:20448096-20448118 CTGGACAAGGAAAATGGGATTGG - Intronic
1005160076 6:22849013-22849035 CAGAATAAGGCATTTGAAATAGG + Intergenic
1005353955 6:24964122-24964144 CAAAACAAGGAAATTGACATTGG + Intronic
1005440842 6:25866123-25866145 CAGAATACGGCAAAGGTGATGGG + Intronic
1005486795 6:26308149-26308171 CAGAATATAAAAAATGTGATAGG + Intergenic
1005671576 6:28111284-28111306 AAGAGTTAGGAAAATGAAATTGG + Intergenic
1005767742 6:29030406-29030428 CAGAATAAAGAAAATCAGCCAGG - Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1007521896 6:42456501-42456523 AAGAAAAAGTAAAAAGAGATAGG - Intergenic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1008133436 6:47744391-47744413 TAGATTAAGGATATTGAGATAGG - Intergenic
1008256077 6:49302310-49302332 ATGAATAATGAAAATGTGATAGG + Intergenic
1008929673 6:56925453-56925475 CAGAAACAGGGAAAAGAGATAGG + Intronic
1009472226 6:64041743-64041765 CAAAATAACGAAAATGAAAGAGG - Intronic
1009486077 6:64223937-64223959 GATAATAAAGAAAATGATATAGG - Intronic
1009694207 6:67077789-67077811 TAGAAAATGAAAAATGAGATTGG + Intergenic
1009763638 6:68039793-68039815 GACAATAAGGAAAATGACTTTGG - Intergenic
1010143404 6:72637972-72637994 AGGAATAAACAAAATGAGATGGG + Intronic
1010289216 6:74115964-74115986 CTGAAGAAGGAAAAAGAGATTGG - Intergenic
1010320344 6:74501085-74501107 CAGAAGAAGTAAAAGGATATGGG - Intergenic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1010396149 6:75394489-75394511 CAAAATAAAAATAATGAGATAGG + Intronic
1010976586 6:82321994-82322016 CAGAATAAGGTAAATGCCACAGG + Intergenic
1010991941 6:82489545-82489567 CAGAAGAAACAAAAAGAGATGGG + Intergenic
1011538509 6:88404344-88404366 CAGAAGAAGAAAAATATGATTGG + Intergenic
1011541033 6:88429247-88429269 CAAAATAAGGAATAAGAGAGGGG - Intergenic
1011648626 6:89484716-89484738 CAGAATACCCATAATGAGATTGG + Intronic
1011931610 6:92721658-92721680 CAGAAGAAAGAAAATGTAATTGG + Intergenic
1011981209 6:93381311-93381333 TAGATTTATGAAAATGAGATAGG - Intronic
1012004798 6:93699844-93699866 CATAGTAGGGCAAATGAGATAGG + Intergenic
1012355410 6:98308047-98308069 CACAATAAAAAGAATGAGATCGG - Intergenic
1012750732 6:103160260-103160282 CAGAATAAGAAATTTGAGGTTGG + Intergenic
1012905469 6:105059874-105059896 GAGAATAAAGAAAATGAAAAGGG - Intronic
1013784288 6:113762440-113762462 CAGAATAATGAAAATTACAGAGG - Intergenic
1013855141 6:114563409-114563431 TAGAAAAAGGAAAAGAAGATTGG - Intergenic
1013948291 6:115748936-115748958 AATAATAAAGAAAATGAAATAGG + Intergenic
1013984986 6:116180731-116180753 CAGAATGAGGAAAGTGCTATGGG + Intronic
1014072015 6:117193232-117193254 GAGAAAAAGCAAAATGAGGTGGG - Intergenic
1014222928 6:118816521-118816543 TAAAATAAAGAAAATGAAATCGG + Intronic
1014395525 6:120923604-120923626 CAGAATATGGCAAAAGAGGTGGG - Intergenic
1014831092 6:126103845-126103867 CAGAATATAGCAAAGGAGATAGG - Intergenic
1015061550 6:128972725-128972747 CAGATTAAAAAAAATGAAATTGG + Intronic
1015076290 6:129162386-129162408 CAGAGTATGGAAAATGGGAAAGG - Intronic
1015159444 6:130136150-130136172 CAGAAGCAGGAAAATGAGTTTGG - Intronic
1015188966 6:130452251-130452273 CAGAATGTGGAAAATGACACAGG - Intergenic
1015429746 6:133117088-133117110 CAGAATATGGCAAAGGTGATGGG + Intergenic
1016132343 6:140490808-140490830 CAGAAGAAAGGAAATAAGATAGG - Intergenic
1016210556 6:141528194-141528216 TAGAATATGGCAAAAGAGATGGG - Intergenic
1017344827 6:153368836-153368858 CAGAATAAGGAAAATTACGAGGG - Intergenic
1017753027 6:157506299-157506321 CCTAATGAGGAAACTGAGATAGG - Intronic
1019949924 7:4363126-4363148 CAGAGTAAGGAAGATGAGGAAGG - Intergenic
1020522472 7:9209652-9209674 AAGAATAATCAGAATGAGATAGG - Intergenic
1020532111 7:9351127-9351149 TAGAATATGGAAAATGTCATGGG - Intergenic
1020887405 7:13835291-13835313 TAGCTTAAGGAAAAAGAGATTGG + Intergenic
1021584267 7:22190996-22191018 CAGATGGAGGAAAATGAGAAGGG - Intronic
1021614743 7:22490319-22490341 CATAATAAGTAAAATAAGGTAGG - Intronic
1021923763 7:25514705-25514727 GAGAGTAAGGAGAATGAGTTTGG - Intergenic
1021934540 7:25616738-25616760 CACAAGAAGGAAAAGGAGAAAGG + Intergenic
1022232905 7:28431170-28431192 TAGAATATGGCAAATGAGATGGG - Intronic
1022827836 7:34034606-34034628 CAGAAAAAGGAAAGTGATATTGG - Intronic
1023130663 7:36999576-36999598 CAGAATAAAGAAAGAGAAATAGG + Intronic
1023673786 7:42608114-42608136 GGGAAAAAGGAAAAAGAGATGGG + Intergenic
1024093846 7:45968852-45968874 CAGAAAAAGGCAAATCAGAAGGG - Intergenic
1024479334 7:49847987-49848009 TAGAATGCAGAAAATGAGATAGG + Intronic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026789730 7:73323877-73323899 CAAAATATGAAAAATGAGCTGGG + Intronic
1027299740 7:76819323-76819345 AATAATAATGAAAATGAGAGTGG - Intergenic
1027569222 7:79842321-79842343 CAGAATATGGAAGAGGAGAAAGG - Intergenic
1028274134 7:88830652-88830674 CAGAAATAGGAAACTGACATTGG + Intronic
1028323533 7:89493280-89493302 CAGATTAAGAAATATGAGGTTGG + Intergenic
1028333497 7:89624782-89624804 CAGAAAAAAGAAAAAAAGATTGG + Intergenic
1028379630 7:90184738-90184760 CATAATAAGTAAAATAAGGTAGG + Intronic
1028397699 7:90390183-90390205 AAGAAAAAGCAAAATGAAATAGG + Exonic
1028496559 7:91467389-91467411 CAGCAGCAGGAAAATGTGATGGG - Intergenic
1028829355 7:95310578-95310600 GAGGATGAGGAAAATGAGATTGG - Intronic
1029651129 7:101892897-101892919 CTGAAGAAGGAAAAAGAGAAAGG - Intronic
1030226211 7:107154327-107154349 CAAAACTAGGAAAATGACATTGG + Intronic
1030986501 7:116247444-116247466 CAGCATAAGGAATATCAGATGGG + Intronic
1031083947 7:117283864-117283886 CAGAAGATGGAAAATGAGAGAGG + Intronic
1031150666 7:118050350-118050372 CAGAAGCAGGGAAAGGAGATTGG - Intergenic
1031216766 7:118902825-118902847 CAAAATTAGAAAAATGAAATGGG - Intergenic
1031908329 7:127486648-127486670 GGGAATAAGGAAAATGGAATAGG + Intergenic
1032293887 7:130617062-130617084 CAGACTAAGAAAAATCAAATTGG + Exonic
1032691750 7:134294394-134294416 CTGAAGAAGGAAAAGGTGATGGG + Exonic
1032707017 7:134429834-134429856 CAGAATAAGACAAGAGAGATGGG + Intergenic
1032846939 7:135759132-135759154 CAGAAAAAAGAAAAGGGGATGGG - Intergenic
1032930576 7:136664038-136664060 CAAAAGAAGAAAAATAAGATAGG + Intergenic
1033007496 7:137583115-137583137 CAGAAAAAAGAAAATTGGATTGG + Intronic
1035120495 7:156562811-156562833 CAGAATGAGGAAGAGGAAATTGG + Intergenic
1036196850 8:6725607-6725629 CAGAATCAGGAAATTGTCATTGG + Intronic
1036682463 8:10885581-10885603 AAGAATTAGGAAAAAGACATGGG - Intergenic
1037040992 8:14233196-14233218 CAGCATAAGGCACATGAGAAAGG + Intronic
1037189886 8:16111499-16111521 CAGGAAAAGGAAACTGAGAGTGG + Intronic
1037483985 8:19330418-19330440 AAGAAGAAAGAGAATGAGATGGG - Intronic
1037513454 8:19606833-19606855 AAGTATAAGGAAAATAATATTGG - Intronic
1038552227 8:28480179-28480201 CTGAAAAAGGAAAATGATAAAGG - Intronic
1038587869 8:28807323-28807345 CAGAAAAAAGTATATGAGATAGG - Intronic
1038813572 8:30877763-30877785 CAAAACTAGGAAAATGACATTGG + Intronic
1038911353 8:31968153-31968175 ATGAATAAAGAAAATAAGATGGG + Intronic
1038987077 8:32823268-32823290 TACATTAAGAAAAATGAGATGGG + Intergenic
1039483297 8:37891648-37891670 CAGTTTAAGTAAAATGAGAAAGG + Intronic
1039683024 8:39763244-39763266 CAGAGTGAGGTAAATTAGATAGG + Intronic
1040374194 8:46807153-46807175 CAGAAGAAACAAAAAGAGATGGG - Intergenic
1040430351 8:47335242-47335264 CAGAAGAAAGAAAATAATATAGG - Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040743721 8:50614190-50614212 AGGAATAAGAAAAATTAGATGGG + Intronic
1040919845 8:52604305-52604327 CAGAAGAAGTAAAAAGGGATAGG + Intergenic
1041793848 8:61725646-61725668 CAGAATAAACAGACTGAGATAGG - Intergenic
1041899929 8:62970946-62970968 CAGAAAAAGAAAAATGACAATGG + Intronic
1042094614 8:65199802-65199824 CACAATAAGAATAATAAGATTGG - Intergenic
1042249085 8:66738078-66738100 CAGTAAAAGGAAAATGAAATTGG - Intronic
1042360363 8:67876119-67876141 CTGGATAAAGAAAATGAGTTAGG + Intergenic
1042451473 8:68952148-68952170 CAGAAAGAGAAAAAAGAGATAGG + Intergenic
1042614521 8:70633752-70633774 TAGAATAAGGGATAAGAGATAGG - Intronic
1043043566 8:75293080-75293102 CATACTGAGGAAAATGAGCTGGG - Intergenic
1043325604 8:79047235-79047257 GAGTAAAAAGAAAATGAGATGGG - Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1044301599 8:90590912-90590934 AAGAATGAAGAAATTGAGATGGG + Intergenic
1044830120 8:96239009-96239031 AAGAATAAGGAAAAGGAAAGTGG - Intergenic
1044937921 8:97310785-97310807 CAGAAGAAGGAAAGTTAGGTTGG - Intergenic
1044950683 8:97432895-97432917 TAGAAGCAGGAAAATGAGTTAGG + Intergenic
1045105246 8:98886248-98886270 CAGAATTAGGAAGTTGACATTGG - Intronic
1045186862 8:99846913-99846935 TAGGAAAAGGAATATGAGATGGG + Intronic
1045206259 8:100044215-100044237 CAGAATGAGCAGAATGAGTTGGG - Intronic
1045438323 8:102186291-102186313 CAGATTAAGGAAATAGAGATTGG - Intergenic
1045721736 8:105119540-105119562 TAAAATAATGAAAATGACATGGG - Intronic
1045743448 8:105388317-105388339 GAGAAAAGGGAAAAGGAGATGGG + Intronic
1046112346 8:109740298-109740320 CAGAATAAGATACAAGAGATAGG - Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046725280 8:117667252-117667274 CAAAATGAGAAAAATGAGTTGGG - Intergenic
1046946621 8:119979895-119979917 CAAAATAAGGGAAATGGGATGGG + Intronic
1047041413 8:121000648-121000670 CACAATAAATAGAATGAGATGGG - Intergenic
1047174552 8:122528134-122528156 GAGAGTAAGGAGAATGAGCTGGG + Intergenic
1047701927 8:127457261-127457283 CAGAATATGGCAAAGGTGATGGG + Intergenic
1047793196 8:128226550-128226572 CAGAATAAGGCAGAAGTGATTGG + Intergenic
1047873433 8:129109952-129109974 CAGAAGAATGAAAATGAGAGGGG - Intergenic
1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG + Intergenic
1048088356 8:131209460-131209482 TAGAATAGAGAGAATGAGATTGG - Intergenic
1048098126 8:131316451-131316473 AAGACTAAGGAAAGTGATATGGG - Intergenic
1049201852 8:141344141-141344163 CAGAACATGGAAAATTAAATAGG + Intergenic
1049282614 8:141758092-141758114 TAGAAAAAGGGTAATGAGATGGG - Intergenic
1050053857 9:1631579-1631601 CAGAAGAGAGAAAATGGGATTGG - Intergenic
1050579635 9:7038834-7038856 AAGAATAAAGAAAATGAAAAAGG - Intronic
1050603423 9:7275357-7275379 CAGAAGAAGGGAAAAGAGCTGGG - Intergenic
1050763921 9:9109042-9109064 AAGAATAAATAAAATGATATGGG + Intronic
1050981853 9:12029061-12029083 AGGAAAAGGGAAAATGAGATAGG - Intergenic
1051171030 9:14317505-14317527 CAGAAAAAGGAAAATGAGATAGG + Intronic
1051462710 9:17340334-17340356 CATAAGGAAGAAAATGAGATTGG - Intronic
1051495844 9:17721897-17721919 GAAAATTAGGACAATGAGATGGG + Intronic
1052088946 9:24303263-24303285 CAGAAGGAGAAAAATGAGAAAGG - Intergenic
1052361827 9:27570563-27570585 CAGAATAAGAAAAAAAAAATGGG + Intronic
1052402786 9:28021744-28021766 CAGAACAAGGAAAATTATCTGGG - Intronic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052673044 9:31582808-31582830 AAGAATAATAAAAATAAGATTGG + Intergenic
1052727940 9:32252383-32252405 GAGAAAAAGGCAAATAAGATTGG + Intergenic
1052810278 9:33052198-33052220 CAGAACTAGGAAATTGACATTGG - Intronic
1054697539 9:68375490-68375512 CAGAAAGAGGAATATCAGATGGG - Intronic
1055039602 9:71855056-71855078 CAGATTAAGGAATATGAGTGAGG + Intergenic
1055426733 9:76204400-76204422 AAGAAAAATGAAATTGAGATGGG - Intronic
1055448759 9:76410952-76410974 CAGAGTAAGGAAAATGATCAGGG - Intergenic
1055558909 9:77503059-77503081 AAGAATAAGGAAGATGAGCAGGG - Intronic
1057267010 9:93624108-93624130 CACAATAGGGAAATTGAGGTAGG - Intronic
1057278793 9:93695733-93695755 CAAAATCAGGAAATTGACATTGG - Intergenic
1057522366 9:95770220-95770242 GAGGACAAGGAAAACGAGATGGG - Intergenic
1057958438 9:99431736-99431758 CAAACTAAGGAAAATAAAATTGG - Intergenic
1058190976 9:101915223-101915245 CACAATCAGGAAATTGACATTGG + Intergenic
1058393434 9:104522851-104522873 CAGAAAAAGGAAATTTACATAGG + Intergenic
1058870727 9:109199364-109199386 CAGAATATGGCAAAAGTGATGGG + Intronic
1059347341 9:113638202-113638224 AAGAATAAGAAAAATTAGCTGGG - Intergenic
1059738521 9:117126908-117126930 AAGAATAATGAAAGTGAGGTTGG + Intronic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1060860023 9:126946571-126946593 CAGAGTTAGGAAAAGGAAATGGG + Intronic
1060898241 9:127233428-127233450 CAGAAGAAGGGAATTGATATTGG + Intronic
1185741386 X:2535623-2535645 AAGAAAAAGGAAAAAGAAATAGG - Intergenic
1186072223 X:5834569-5834591 CAGTATTGGGAAAATGAGAAAGG - Intergenic
1186090032 X:6037015-6037037 AAGAATTTGGAAAATGATATGGG + Intronic
1186640906 X:11454387-11454409 CAGAGTAAAGAAAAAGAGAAAGG + Intronic
1186840785 X:13483076-13483098 CAGGACATGGAAAATGAGAAGGG + Intergenic
1187088131 X:16063505-16063527 CAAAATAATGAAATTGACATTGG + Intergenic
1187827714 X:23348802-23348824 AAGAAAAAGGAAAATTATATAGG + Intronic
1188033208 X:25287805-25287827 AAGAAGAAGGAAAAAGAGAGGGG - Intergenic
1188783322 X:34311916-34311938 CTGAAGAAGGAAAATTTGATAGG - Intergenic
1188809485 X:34635346-34635368 AAGAGTATGGAAAATGAGACGGG - Intronic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189097235 X:38153538-38153560 CAGAAAGAAGAAAATGAAATGGG - Intronic
1189372156 X:40437362-40437384 CAAATTAATGAATATGAGATTGG + Intergenic
1189591658 X:42518775-42518797 CAGAATATGGCAAAGGCGATGGG - Intergenic
1189920824 X:45901570-45901592 CATAATCAAGAAAATGAGGTTGG + Intergenic
1189938069 X:46090370-46090392 CAGAATAATGAAAAAGAAAAGGG + Intergenic
1190211156 X:48449123-48449145 CAAAATCAGGAAATTGACATTGG - Intergenic
1190241884 X:48663147-48663169 CAGAATATGGCAAAAGTGATAGG + Intergenic
1190441724 X:50481621-50481643 CAGAATATGGCAAAGGTGATGGG - Intergenic
1190510250 X:51167064-51167086 CTGAATATATAAAATGAGATTGG - Intergenic
1190866914 X:54392479-54392501 AATAAAAAGGAAAATTAGATGGG - Intergenic
1190946618 X:55101014-55101036 CAAAATCAGGAAATTGACATTGG - Intronic
1191009668 X:55747557-55747579 CAAAATAACAAATATGAGATTGG - Intronic
1191178645 X:57535947-57535969 CACAAGAAGAAGAATGAGATTGG - Intergenic
1191734214 X:64372260-64372282 CAAAACCAGGAAAATGATATTGG + Intronic
1191926052 X:66311292-66311314 CAGAATATGAAAGATCAGATTGG + Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1194027541 X:88771197-88771219 ATGAATGAGGAAAATGAGAAAGG + Intergenic
1194101704 X:89713527-89713549 CAGAACAAGAACAATGAGAAAGG - Intergenic
1194299913 X:92173352-92173374 TAGAATAAAGAAAATGAAAAAGG + Intronic
1194391828 X:93328272-93328294 CTGAACAAGGAAAAAGAGATAGG + Intergenic
1194697959 X:97079156-97079178 CAGAGTAAGTAAAATGCAATAGG - Intronic
1194711874 X:97245423-97245445 TAAAAAAAAGAAAATGAGATGGG - Intronic
1195118471 X:101724053-101724075 CAGAATAAGAAAATTCAGAGGGG - Intergenic
1195930128 X:110066096-110066118 AAGAAGAATGAAAATGAGAAAGG - Intronic
1197080979 X:122416104-122416126 CAGAATGAGGATTATGAAATTGG + Intergenic
1197409644 X:126099369-126099391 CAGAAAAATGAAAAAAAGATGGG - Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198629090 X:138615617-138615639 AAGAATAAGGATAATGCAATGGG + Intergenic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1199655141 X:149986985-149987007 CAGTATAAGGAATAAGATATTGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200454652 Y:3374611-3374633 CAGAACAAGAACAATGAGAAAGG - Intergenic
1200783786 Y:7240622-7240644 CAGAACAAAGAAGATTAGATTGG + Intergenic
1201396365 Y:13553262-13553284 GAAAAGAAGGAAAATGTGATAGG - Intergenic
1201620948 Y:15957173-15957195 TAGAATAAGGAAAGTGTGAGGGG - Intergenic
1201905947 Y:19085828-19085850 TAGAATTAGGAAAATGAAAAGGG + Intergenic