ID: 930044199

View in Genome Browser
Species Human (GRCh38)
Location 2:47154891-47154913
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930044195_930044199 -1 Left 930044195 2:47154869-47154891 CCATATTAAAGCAGTTGTCCAGT 0: 1
1: 0
2: 2
3: 8
4: 168
Right 930044199 2:47154891-47154913 TTTAATTAGTAGTGGGAAGAAGG 0: 1
1: 0
2: 1
3: 26
4: 278
930044194_930044199 6 Left 930044194 2:47154862-47154884 CCAATCACCATATTAAAGCAGTT 0: 1
1: 0
2: 0
3: 8
4: 151
Right 930044199 2:47154891-47154913 TTTAATTAGTAGTGGGAAGAAGG 0: 1
1: 0
2: 1
3: 26
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901716410 1:11158295-11158317 TTTATTTAGAAAGGGGAAGAGGG - Intronic
906740079 1:48174118-48174140 TATAATAAGATGTGGGAAGAGGG + Intergenic
909259032 1:73463563-73463585 TTTATTTGGTAGTGGGTAGTAGG - Intergenic
909366844 1:74834631-74834653 TTTAACTAATGATGGGAAGATGG + Intergenic
910911615 1:92240694-92240716 TTTAATTTTTAGTAGAAAGAAGG + Intronic
911314435 1:96339138-96339160 TCAGGTTAGTAGTGGGAAGAAGG + Intergenic
911674541 1:100644552-100644574 TTAAAGTAGTGGTGGGAGGAAGG - Intergenic
911906907 1:103581080-103581102 TTTAATTAGGAGAGGGAGCAAGG - Intergenic
915684144 1:157614736-157614758 TTTAAATAGAAGTGGTGAGATGG - Intergenic
916308248 1:163364116-163364138 TTTTATTAAAAGTTGGAAGAAGG - Intergenic
916493121 1:165319180-165319202 TTTAAATAGTAGAGGTAATATGG - Intronic
916901237 1:169226093-169226115 TATAATTAGTGCTTGGAAGATGG - Intronic
917271549 1:173280392-173280414 TCTAACTAGTAGTTGGCAGATGG + Intergenic
918748892 1:188244710-188244732 ATTAATTAGTAATGTGAAAAAGG + Intergenic
919654792 1:200186508-200186530 TTTAATGAGTTGAGAGAAGAAGG + Intergenic
921830037 1:219717802-219717824 TTTAATTAGTAGTGGAAGAAAGG - Intronic
922328006 1:224546988-224547010 AGTAATTGGTAGTGGTAAGATGG + Intronic
924695858 1:246398889-246398911 TTTTATTAATAGTAGAAAGAGGG - Intronic
1063270501 10:4504822-4504844 TTTAAATTGTAGTGGGATGCAGG + Intergenic
1063285161 10:4678999-4679021 TTTACTTAGTAGGGGGAGGTAGG - Intergenic
1063301497 10:4853310-4853332 ATAAATTAGTAGTTGGAAAAAGG + Intergenic
1064211493 10:13363895-13363917 TTTAATTAGTGGAGGCAGGACGG - Intergenic
1064272659 10:13879506-13879528 TTTATTTATTTGTGGGGAGATGG - Intronic
1064881773 10:20063609-20063631 TTTAATAATTAGTGTGAAAATGG + Intronic
1065415422 10:25480238-25480260 TTTAAATATTGGTGGGAAGGGGG - Intronic
1066250377 10:33627094-33627116 TTCCATTATGAGTGGGAAGATGG + Intergenic
1068871789 10:61953168-61953190 TAGAATGAGTAGTTGGAAGATGG - Intronic
1069065794 10:63940728-63940750 TTTAATTATTGGTTGTAAGAAGG - Intergenic
1069066704 10:63949629-63949651 TTTGATTAGTTGAGAGAAGAAGG - Intergenic
1072305797 10:94105802-94105824 TTTAATTAGCAGAGGACAGAAGG - Intronic
1072697882 10:97617510-97617532 TTTAATCTGTAGTGATAAGATGG - Intronic
1072934867 10:99702416-99702438 TTTAATAACTTGTGGGAATACGG + Intronic
1073296850 10:102445477-102445499 TTTTATTATTAGTGGGTGGAGGG - Intergenic
1073575761 10:104621924-104621946 TATAATCAGTTCTGGGAAGATGG + Intergenic
1073896546 10:108166820-108166842 TTTAATTAGAGGTGGGAAACAGG - Intergenic
1074567007 10:114588856-114588878 TTGAATTGGTAGTGGGGTGATGG - Intronic
1074581042 10:114719765-114719787 TTTAATTAGCCCTGGGAAGACGG - Intergenic
1074641478 10:115388056-115388078 TTTTATGTGTAGTGGGAAGAAGG + Intronic
1083009802 11:59386632-59386654 TTTAATGAGTTGAGAGAAGAAGG - Intergenic
1085381809 11:76126691-76126713 TTTAATTAGTTGTGTGCAAAAGG - Intronic
1085664871 11:78405622-78405644 TGTACTTAGTGGTGGGAATAGGG - Intronic
1086529091 11:87763373-87763395 TTTGATTAGTTGAGAGAAGAAGG - Intergenic
1087111951 11:94480073-94480095 TTTTATTCGTAGTGGGGGGAGGG + Intronic
1087311760 11:96552093-96552115 TTTAATTCGTAAGGAGAAGAGGG - Intergenic
1087333055 11:96807427-96807449 TATACTTAGTAGTGAGAAGGTGG - Intergenic
1095847363 12:46760023-46760045 CTTTATTAGTAGTGTGAAAAAGG + Intergenic
1095867940 12:46992956-46992978 TTTGATTAGTTGAGAGAAGAAGG + Intergenic
1096712375 12:53466806-53466828 TTTCATCAGTATTGGGGAGAGGG - Intronic
1098558337 12:71844458-71844480 TTTAATTAGTAGAGGGTATAGGG - Intronic
1099018253 12:77371440-77371462 TTTAGTTACCAGTGGGAAGAGGG + Intergenic
1099383767 12:81989023-81989045 TTTTATTAGTAGTGTGAGAATGG - Intergenic
1099543324 12:83943189-83943211 TTTAATTTGTAGTAGAAATAGGG + Intergenic
1101044338 12:100789082-100789104 TTCCATGAGTGGTGGGAAGAAGG - Intronic
1101211272 12:102537451-102537473 TTTACTTAGTTCTGGGGAGACGG - Intergenic
1103151971 12:118648645-118648667 GTTAATTAGTAGTTGGATGCAGG + Intergenic
1106272004 13:28163909-28163931 TTTAATTAGTAGAGGAAAAGGGG - Intronic
1106285906 13:28317899-28317921 TTTAGTTACTTGTGGGGAGAAGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107731088 13:43349869-43349891 TTTAATTGGTCGTGGGGACAGGG - Intronic
1108193457 13:47967212-47967234 TTTAAAAAGTTGGGGGAAGAGGG + Intronic
1109857048 13:68144202-68144224 TTTAATTAGTAGTAGAATGTGGG - Intergenic
1111371101 13:87318823-87318845 ATTAATTAGTGTTGGAAAGAAGG + Intergenic
1111576307 13:90158084-90158106 TTTAAATAGTGCTTGGAAGATGG + Intergenic
1112033840 13:95479949-95479971 CTTTATTAGCAGTGTGAAGATGG - Intronic
1112867221 13:103919507-103919529 TTTAATAAATAATGGGAAAAGGG + Intergenic
1114391310 14:22311543-22311565 TTGAATTAGTGGTTAGAAGAGGG - Intergenic
1115383093 14:32762124-32762146 TTTTAGTAGTAGGGGGAAAAAGG - Intronic
1117226383 14:53664707-53664729 TTTAATAAGTGGTGGGATCATGG - Intergenic
1117546167 14:56796296-56796318 TTTAATTCTTAGTGGAAACACGG - Intergenic
1118473937 14:66099874-66099896 TTTAATAAGTTGTGGTGAGATGG - Intergenic
1118580607 14:67292754-67292776 GGTAATTAGTAGTGGCAGGAAGG + Intronic
1119672781 14:76532099-76532121 TTGTAATATTAGTGGGAAGAGGG - Intergenic
1121023468 14:90597293-90597315 TTGAATTAGTATTGGAAGGAGGG + Intronic
1121033284 14:90677565-90677587 GTTAATTAGCAGAGGGAAAAAGG - Intronic
1124180807 15:27471746-27471768 TTAAATTAGTAGGAGGAAGAAGG - Intronic
1124447519 15:29750735-29750757 TTTAATTTGTAATGGGGAGTTGG - Intronic
1125024349 15:35015700-35015722 TTTATTTAGAAGAGGGAAGGAGG + Intergenic
1125243707 15:37608106-37608128 TATAAATAGGAGTGAGAAGAGGG + Intergenic
1125463239 15:39926033-39926055 GTTTATTAGTAGTGGCAAAAAGG + Intergenic
1126539406 15:49805169-49805191 ATTAATTAGCAGTGTGAAAATGG - Intergenic
1127056239 15:55135216-55135238 TTACATTAGAAGTGGTAAGAGGG + Intergenic
1127260128 15:57321322-57321344 TTTAATTATTTGTGGAAACAAGG - Intergenic
1127642744 15:60931045-60931067 TTTAAATGGCAGGGGGAAGAGGG + Intronic
1130133681 15:81163997-81164019 TTTAAATTGTAGTGTGAAGTTGG - Intronic
1130767519 15:86886721-86886743 TTCAATTAGCCGTGGCAAGAAGG + Intronic
1135529302 16:23238929-23238951 TTTTATTAGCAGTGTGAAAACGG - Intergenic
1137041359 16:35615814-35615836 TTTTATGGGTAGTAGGAAGAAGG + Intergenic
1137664542 16:50242026-50242048 TCTAATTAGAAAAGGGAAGAAGG - Intergenic
1138312135 16:56035426-56035448 TTTAATTAATATTGGGTAAATGG + Intergenic
1140430493 16:74898785-74898807 TTTAAATAGCAGTGGGAGCAGGG + Intronic
1141204905 16:81926080-81926102 TTAAATTAGTGGGGGGAAGTTGG + Intronic
1144118259 17:12122702-12122724 TTTAATTAATATTGGGCATAAGG - Intronic
1145716714 17:27029740-27029762 TTTGATGAGTAGAGAGAAGAAGG + Intergenic
1146115151 17:30130038-30130060 TTCTATTAGAAGTGGGGAGATGG + Intronic
1146615403 17:34353136-34353158 TTTGATGAGTTGTGGGAGGAGGG + Intergenic
1149171591 17:53818651-53818673 TTTAATAAGCAGGGGAAAGATGG + Intergenic
1151076246 17:71276337-71276359 TTTTAGTAGCAGTAGGAAGAAGG - Intergenic
1151398000 17:73837348-73837370 TTAAATATGGAGTGGGAAGAGGG + Intergenic
1153489697 18:5634443-5634465 ATTAATTACCAGTGGGAAAATGG - Intergenic
1154107764 18:11537745-11537767 AGAAATTAGTAGTGGGGAGAGGG + Intergenic
1156521189 18:37723577-37723599 TTAAAATAGTGCTGGGAAGAAGG + Intergenic
1157047403 18:44119069-44119091 TTTCATTAGTACTTGGAAGATGG - Intergenic
1157170928 18:45404439-45404461 CTTCATTACTAATGGGAAGAAGG - Intronic
1157254729 18:46128576-46128598 TTAAATCAGTAGTAGAAAGATGG + Intergenic
1157777748 18:50409249-50409271 TTTACTTGGTAGTCAGAAGAGGG + Intergenic
1157994442 18:52538251-52538273 TTGACTTAGTACTGTGAAGAAGG - Intronic
1160076017 18:75678536-75678558 ATTATTTAATATTGGGAAGAAGG + Intergenic
1161826209 19:6567694-6567716 TGTCAGTAGCAGTGGGAAGAGGG - Intergenic
1164466898 19:28494792-28494814 TGTAATTTGTAGGGGGAAAATGG - Intergenic
1164541257 19:29123128-29123150 TTTAATTAGCAGTGTGAAAATGG - Intergenic
1166983258 19:46644328-46644350 TTTAATTATTAGTGGAGACAGGG + Intergenic
1168439935 19:56355839-56355861 TTGAATCAGGATTGGGAAGAAGG + Intronic
925395517 2:3530585-3530607 TATTATTAGTAGGGGGAAGAAGG + Intergenic
925395547 2:3530860-3530882 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
925395553 2:3530923-3530945 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
928230238 2:29492455-29492477 AGTCATTAGGAGTGGGAAGAGGG + Intronic
929133147 2:38598193-38598215 ATTAATTAGACGGGGGAAGAGGG + Intronic
930044199 2:47154891-47154913 TTTAATTAGTAGTGGGAAGAAGG + Intronic
930367767 2:50462802-50462824 TATAATTAACAATGGGAAGATGG - Intronic
930575061 2:53136476-53136498 TTTAATGGGAAGTGGGAGGATGG + Intergenic
930844970 2:55893686-55893708 TTAAATTGGTAGTGGGATCAGGG + Intronic
931471966 2:62547445-62547467 TAATATTAGTAGTGGGAAGAGGG - Intergenic
931669833 2:64637008-64637030 ATTAATTAGGGGTGGGAGGAAGG + Intronic
932043239 2:68321252-68321274 GTTTATGAGTAGTGGAAAGAGGG + Intergenic
932513258 2:72317166-72317188 TTTAAATAGTAGGTGGCAGAAGG + Intronic
932828903 2:74969167-74969189 TAGAATTAGAAGTGGGAAAAGGG - Intronic
937458721 2:122067082-122067104 TTTAAGTACTATTGGGAAGATGG + Intergenic
938446592 2:131385353-131385375 TTTAATTAAGATTGGGATGAGGG + Intergenic
939071705 2:137552049-137552071 TGCAATTATTTGTGGGAAGATGG - Intronic
939820563 2:146952126-146952148 TTTAATTAGTAGTTAGCATATGG - Intergenic
940607409 2:155943747-155943769 TTAACTTAGTATTGGAAAGATGG + Intergenic
941437048 2:165485701-165485723 TTTATTTATTAATAGGAAGATGG - Intronic
941727453 2:168878184-168878206 TTTATATAGTTGTGGGCAGAGGG - Intronic
942715718 2:178889610-178889632 TTTAATTAGTAATGAAATGAGGG + Intronic
943534461 2:189130186-189130208 TTTAGTAATTTGTGGGAAGATGG + Intronic
944086489 2:195853011-195853033 TTTAAAAAGTAATGGGAAAATGG - Intronic
944256860 2:197631963-197631985 TTTAATTAGAAGAGGGAGAATGG - Intronic
945447916 2:209960014-209960036 AGTAAATAGTAGTGAGAAGAAGG - Intronic
945498770 2:210542452-210542474 TTTACTTGGTAGTGTGAAAATGG - Intronic
947476479 2:230453014-230453036 TTTTATTAGCAGTGTGAGGATGG - Intronic
947930004 2:233956824-233956846 TTTAATTAGTGGAGGGAAAGTGG + Intronic
1169944123 20:10970692-10970714 TGTAATTAGTATTGGGAACTGGG + Intergenic
1170563405 20:17578068-17578090 CTTAATTTGTAATGGGAAGTTGG + Intronic
1174073682 20:47916788-47916810 CTTCCTTAGGAGTGGGAAGAAGG + Intergenic
1174136021 20:48380404-48380426 TTTCATTTGTAGGGGGAAAAAGG + Intergenic
1175283682 20:57821986-57822008 TTCATTGTGTAGTGGGAAGATGG - Intergenic
1175346675 20:58284042-58284064 TTGAATTGGTAGGGAGAAGATGG - Intergenic
1176968925 21:15243619-15243641 CTGAATTTGAAGTGGGAAGAAGG + Intergenic
1178053982 21:28778742-28778764 TTTAATTAGTAAAGGGCAAAAGG - Intergenic
1179560122 21:42210398-42210420 TTTAATTATTTGTGGGAAGGAGG + Intronic
1182510059 22:30813122-30813144 TTTTAGTAGTAGGGGGAAAATGG + Intronic
1183883839 22:40859650-40859672 TTTGATTTTTAGTGGGCAGATGG - Exonic
950057911 3:10042435-10042457 CTAAATTATAAGTGGGAAGATGG + Intronic
951185539 3:19708252-19708274 TTTGATAAGAAGTGGGAAGCAGG + Intergenic
951482984 3:23181375-23181397 TTTCATTAGTATTGTGAAGATGG - Intergenic
951493664 3:23301268-23301290 TTTGATTAGTTGAGAGAAGAAGG - Intronic
951871918 3:27371042-27371064 TTTACTGAGTAGTGGAAAGATGG - Intergenic
952252556 3:31668913-31668935 TTTAATCAGAAATGGGAAGGAGG + Intronic
954534196 3:51346062-51346084 TTTTATTAGTATTGAGAAGTTGG + Intronic
955094761 3:55786475-55786497 TATAATTAGCAGTGGTAACAAGG - Intronic
959032229 3:101312911-101312933 TTTACTTAGGCCTGGGAAGAGGG + Intronic
960009219 3:112815034-112815056 TTTATATAGCAGTGGGAGGATGG + Intronic
960257623 3:115527685-115527707 CTTTATTAGTAGTGTGAAAATGG + Intergenic
960858409 3:122126567-122126589 GAGAATTAGTAGTGGGAGGATGG + Intergenic
961174802 3:124825886-124825908 TTTTATTAATAGTGAGAAAAAGG + Intronic
962987575 3:140549552-140549574 TTTAATTTGTTGTGAGAAGTAGG - Intronic
962987736 3:140551007-140551029 TTTAATTTGTTGTGAGAAGTAGG - Intronic
963648904 3:147951669-147951691 TTTAATTAATTGTTGGAAAATGG - Intergenic
963833429 3:150032994-150033016 TTTAATTAGAAATGGGAAATGGG - Intronic
963863226 3:150332197-150332219 TTTCAACACTAGTGGGAAGAAGG - Intergenic
964100379 3:152981348-152981370 TTTGATGAGTAGCGAGAAGAAGG + Intergenic
964969817 3:162545727-162545749 CTTTATTAATAGTGGGTAGAAGG - Intergenic
966615827 3:181911475-181911497 TTTACTTACTAATGGGAAGAGGG + Intergenic
966635635 3:182130142-182130164 TTTAATTAGTATCAGGTAGAGGG - Intergenic
966666995 3:182482415-182482437 TTTAATTATTTTTTGGAAGAAGG - Intergenic
967469153 3:189842638-189842660 TTTAATCAGCACTGAGAAGAGGG + Intronic
968914192 4:3490033-3490055 ATTAATGAGTAGGAGGAAGAAGG - Intronic
970983087 4:22124152-22124174 TTTAATGAGTTGAGAGAAGAAGG + Intergenic
971238072 4:24861823-24861845 TGTAATAAGAAATGGGAAGATGG + Intronic
972317772 4:37943819-37943841 TTTGATGAGTTGAGGGAAGAAGG - Intronic
976378770 4:84375771-84375793 TTTAATTAGGAAAGGGTAGACGG - Intergenic
979058234 4:116020806-116020828 GTTAAATAGAAGTGGTAAGAAGG - Intergenic
979097953 4:116574502-116574524 TTTTATTAGTAGGGTGAAAATGG - Intergenic
979177032 4:117678411-117678433 CTTTATTAGCAGTGGGAAAATGG + Intergenic
979547982 4:121958538-121958560 TTTAAATAGTTTTTGGAAGAGGG - Intergenic
979560063 4:122091578-122091600 TTTGATTAGTTGTGAGAAGGAGG - Intergenic
979743598 4:124181146-124181168 TTCAATTAGTTCTGGGAAAATGG - Intergenic
979808517 4:125005355-125005377 TTTTGTTAGTAGTTGGAGGAGGG - Intergenic
980675610 4:136075490-136075512 TATAAATAGGAGTGGAAAGAAGG + Intergenic
980763969 4:137274437-137274459 TTTAAAAAGTAGTGGGAACAGGG + Intergenic
982493925 4:156066200-156066222 TGAAATTAGTACTGGGAAAAAGG - Intergenic
982817418 4:159904091-159904113 TTTGATTAGTAGTATGATGATGG - Intergenic
982890141 4:160837061-160837083 TTTAATTAGTGGGGATAAGAGGG - Intergenic
983840218 4:172448987-172449009 GTTAATTAGTTGAGGGATGAGGG - Intronic
984131424 4:175879729-175879751 AATAATTAGTGGAGGGAAGAAGG - Intronic
984168105 4:176327097-176327119 TTTAATTTGAAGTGATAAGATGG + Intronic
984190266 4:176596980-176597002 TGTAATAACTAGTGGGAATATGG - Intergenic
984991834 4:185388320-185388342 TTTAATTAATATTGGGAATAAGG - Intronic
986084474 5:4430301-4430323 TTTAAGTAATAATGGTAAGAAGG + Intergenic
990119731 5:52436183-52436205 TCTAATTAGTCGTGGGTAGGTGG + Intergenic
992681105 5:79153997-79154019 ATTTCTTAGGAGTGGGAAGATGG - Intronic
993600181 5:89912944-89912966 TTAAAGTAGAAGTGGGAAGTTGG - Intergenic
994224721 5:97239252-97239274 TTTGATGAGTAGAGAGAAGAAGG - Intergenic
994474696 5:100251739-100251761 TAGAATTAGTAATGAGAAGAGGG - Intergenic
996444703 5:123533540-123533562 TTTTATTATTAGTTGGAAGTTGG + Intronic
997148195 5:131461079-131461101 TTTCATAATAAGTGGGAAGAAGG + Intronic
999228274 5:150045605-150045627 TCTCATGAGTGGTGGGAAGAAGG - Exonic
999783583 5:154871049-154871071 TTTAATTCCAAGTGGGAATATGG + Intronic
999852204 5:155553723-155553745 TTTATGTATTAGTGGAAAGATGG - Intergenic
1001165659 5:169363959-169363981 TTGAAATAGAAGTGGCAAGAGGG + Intergenic
1002496877 5:179621474-179621496 TGTAATTTGTAGTGGGGACATGG - Intronic
1002682027 5:180973177-180973199 GTTAAATAGAAGTGGCAAGAAGG - Intergenic
1004500729 6:16207764-16207786 TTTATTTAGTAGTGGGCTAAGGG - Intergenic
1005040923 6:21599467-21599489 TTTAATTAACATTTGGAAGATGG - Intergenic
1006465094 6:34188800-34188822 ATTTATTAGTAGTTGGAAGGCGG - Intergenic
1007657209 6:43457942-43457964 TTTGCTTTGTAGTGGGGAGATGG - Intergenic
1008302373 6:49856854-49856876 TTTAATTATTAGTGAGATTAAGG + Intronic
1008649979 6:53552036-53552058 TTTTATCAGCAGTGTGAAGATGG + Intronic
1009189558 6:60613217-60613239 TATAATTAATATTGGAAAGAAGG - Intergenic
1009490620 6:64285629-64285651 TTTTATTAATAGTGTGAAAATGG - Intronic
1009826901 6:68878722-68878744 TTTTATCAGTAGTGTGAAAATGG - Intronic
1010170924 6:72974543-72974565 TTTAGAGAGTAGTGGGAGGAGGG - Intronic
1010993025 6:82501421-82501443 TTTAATGAGTTGAGAGAAGAAGG - Intergenic
1011376615 6:86694361-86694383 TTTGATGAGTTGAGGGAAGAAGG - Intergenic
1012356851 6:98324814-98324836 TATAATGAGCAGTGGCAAGAGGG - Intergenic
1012794476 6:103742150-103742172 TTTAATTGGGAGTGGGGAGAAGG + Intergenic
1014135712 6:117886538-117886560 CTCAATTAGTAGTGGAAACATGG - Intergenic
1015073206 6:129122886-129122908 TTTAATTATCAGTGTTAAGAAGG - Intronic
1015367938 6:132418173-132418195 GTTTATTAGTAGTGTGAAAATGG - Intergenic
1016068806 6:139712677-139712699 TTTAATTATTAGTGTTAAGCAGG - Intergenic
1016125822 6:140401883-140401905 TTAAACTAGTAATGGGAGGAGGG - Intergenic
1017201658 6:151761121-151761143 AATAATTAGTAGTGGGAAAATGG - Intronic
1018400982 6:163419527-163419549 TTGAATTAGTTGTAGCAAGAAGG + Intronic
1018483573 6:164216517-164216539 TTTAATTAATACTGTGGAGAGGG - Intergenic
1018931708 6:168244238-168244260 TTTAACTCTCAGTGGGAAGAGGG + Intergenic
1019315556 7:382895-382917 TTAAATGAGAAGTGGGAAGAAGG + Intergenic
1020503689 7:8956370-8956392 TTTATTTAGTAATAGGAAGCAGG - Intergenic
1021587966 7:22230085-22230107 TTAAATTACTAGTGGGACAAGGG - Intronic
1021757298 7:23864909-23864931 TTTAACTAGTAATGGAAAAATGG - Intergenic
1022963652 7:35453892-35453914 TTTAATGGGTAATGGAAAGAAGG - Intergenic
1023190072 7:37570757-37570779 TAGCATTAGTAGTTGGAAGAAGG + Intergenic
1026540023 7:71271764-71271786 TTTATTTAGTGGTGGGGACAGGG + Intronic
1028123051 7:87078691-87078713 TTTAATCAGCAGTGTGAAAATGG - Intergenic
1028234904 7:88348587-88348609 TTTAACTAGAAGGAGGAAGAAGG + Intergenic
1029638968 7:101806244-101806266 TTTAGTTGGGAGTGGGAACAGGG - Intergenic
1030435790 7:109518346-109518368 TTTAATGTATAGTGGAAAGAAGG + Intergenic
1031552475 7:123132224-123132246 TTTTATTAGTAGTGAGAAGATGG - Intronic
1032423750 7:131803651-131803673 TTTAAATAGTAGAGGAAGGATGG + Intergenic
1032809007 7:135390282-135390304 TTCAATTAGTAGTGGAATTAGGG - Intronic
1032849807 7:135784404-135784426 TTACAGAAGTAGTGGGAAGAGGG - Intergenic
1033807201 7:144968206-144968228 TTTAAAAAGCTGTGGGAAGAAGG - Intergenic
1035017479 7:155779210-155779232 TTTAATTTGGAGTGGGAGGGAGG + Exonic
1035334366 7:158116275-158116297 ATGAATTAGTTTTGGGAAGATGG + Intronic
1037295168 8:17391874-17391896 TTTAAATGGTTGTGGGAGGAAGG + Intronic
1037453126 8:19037006-19037028 TCTAATTAGTGGTGGGAGTAGGG - Intronic
1038443708 8:27588652-27588674 ATTAATTAGCAGTGGAAATAGGG + Intergenic
1040741225 8:50578860-50578882 CTTAATTAGCAGTGTGAAGATGG + Intronic
1040744456 8:50624023-50624045 TTGAATTAGTATTTGTAAGAGGG - Intronic
1041257730 8:55993709-55993731 TTCAATTAGTGGTGGGGAAATGG + Intronic
1042720468 8:71821404-71821426 TTTAATGAGTTGAGAGAAGAAGG + Intergenic
1042858630 8:73293053-73293075 TTTAATTAGTCGTCGGAGGCCGG - Intronic
1045419639 8:102001033-102001055 TTTGATGAGTAGAGAGAAGAAGG + Intronic
1046508772 8:115171938-115171960 CTTTATTAGTAGTGTGAGGATGG - Intergenic
1046905340 8:119566359-119566381 TTTAATAAGGGGAGGGAAGAGGG - Intronic
1046921561 8:119734815-119734837 TTAAATTAGTTGGGGGAAGAGGG + Intronic
1046970286 8:120215586-120215608 TATTAATAGTAGGGGGAAGATGG + Intronic
1047141532 8:122146179-122146201 TTTAAGTAGCAGTGGACAGATGG + Intergenic
1047306385 8:123656264-123656286 TTTAATTAGTAAGGGGATGTAGG - Intergenic
1048458020 8:134595719-134595741 TTTAGTTACTAATTGGAAGAAGG + Intronic
1048602411 8:135932161-135932183 TGTAAGTAGTAGTAGGAGGAGGG + Intergenic
1050333214 9:4566123-4566145 TTTAATTGATAATGGGAAGAGGG - Intronic
1050813664 9:9781257-9781279 TTTAACTGACAGTGGGAAGAGGG + Intronic
1051570552 9:18553240-18553262 TTAAACCAGTAGAGGGAAGAGGG - Intronic
1052510207 9:29408194-29408216 GTTAACTAGTACTAGGAAGAGGG - Intergenic
1052578080 9:30316401-30316423 ATTAATTAGTAGAGGGAACATGG - Intergenic
1052942924 9:34144706-34144728 TTTGATTAGAAGGGTGAAGAAGG + Intergenic
1055252892 9:74329808-74329830 ATTAAATAGTACTGGGAAAAAGG - Intergenic
1056326433 9:85483248-85483270 TTTAAATAGTAAATGGAAGAAGG + Intergenic
1057400595 9:94719905-94719927 TTCTATTACTAGGGGGAAGAGGG + Intergenic
1057541029 9:95970284-95970306 TAAAAGTACTAGTGGGAAGAGGG - Intronic
1058275392 9:103035643-103035665 TTTAAATAGTAGTGAGAAAATGG - Intergenic
1058727765 9:107819438-107819460 TTTCATTAGTTGTGGGGAAAGGG + Intergenic
1059363110 9:113762988-113763010 TATACTAAGTAGTGGCAAGAAGG + Intergenic
1186125565 X:6410110-6410132 TTTATTTTGTACTGGGAAGCTGG - Intergenic
1186293465 X:8123956-8123978 TTTGATGAGTATTGAGAAGAAGG - Intergenic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1186751769 X:12628820-12628842 CTTTATTAGGAGTGTGAAGACGG - Intronic
1186923356 X:14305853-14305875 TGTTATTAGTAGGGGGAAAAGGG + Intergenic
1188153782 X:26715410-26715432 TTAAATTAGTAGAGGGACTAGGG - Intergenic
1188410744 X:29869325-29869347 TTTAATAAGAAGTGGGAATGTGG - Intronic
1190954582 X:55180026-55180048 TTTAATTAGGATTGGGATAAGGG + Intronic
1191184640 X:57596093-57596115 ATTATTCAGTAGAGGGAAGAGGG - Exonic
1191838944 X:65495740-65495762 TTTAAATAGAAATTGGAAGAGGG - Intronic
1192029080 X:67489500-67489522 TTTAACGAGTAGAGAGAAGAAGG + Intergenic
1192917123 X:75664832-75664854 CTTAATTAGCAGTGTGAAAATGG - Intergenic
1194638359 X:96373204-96373226 ATAAATTAGTGGTGGGGAGAGGG + Intergenic
1195242252 X:102963914-102963936 TTTAGTTATTAGTGAGAAAATGG + Intergenic
1195962315 X:110398405-110398427 TTTATTTTTTAATGGGAAGAAGG - Intronic
1196883560 X:120222570-120222592 TGTAATCAGTACTGGGAATAGGG + Intergenic
1197407583 X:126071141-126071163 TATACTGAGGAGTGGGAAGAAGG + Intergenic
1197416140 X:126175625-126175647 TTTAAGTAGTTGTGGAAATAAGG + Intergenic
1197909024 X:131460443-131460465 GTTGAATAGTAGTGGTAAGAGGG - Intergenic
1197916763 X:131544047-131544069 TTTAATGAATAGTGGCAAGAGGG + Intergenic
1199458816 X:148060186-148060208 TTAAATTGGTACTGGGAAGTGGG - Intergenic
1200330480 X:155291552-155291574 TTTAAATAAGAGTGGTAAGAAGG + Intronic
1202022345 Y:20478301-20478323 TTTGATGAGTTGAGGGAAGAAGG + Intergenic