ID: 930046781

View in Genome Browser
Species Human (GRCh38)
Location 2:47179560-47179582
Sequence TCATTAGCACAGATGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930046781_930046788 -3 Left 930046781 2:47179560-47179582 CCTCCAGCCATCTGTGCTAATGA No data
Right 930046788 2:47179580-47179602 TGACCAAGGTGAAGGGCAAAGGG No data
930046781_930046786 -10 Left 930046781 2:47179560-47179582 CCTCCAGCCATCTGTGCTAATGA No data
Right 930046786 2:47179573-47179595 GTGCTAATGACCAAGGTGAAGGG No data
930046781_930046787 -4 Left 930046781 2:47179560-47179582 CCTCCAGCCATCTGTGCTAATGA No data
Right 930046787 2:47179579-47179601 ATGACCAAGGTGAAGGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930046781 Original CRISPR TCATTAGCACAGATGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr