ID: 930053690

View in Genome Browser
Species Human (GRCh38)
Location 2:47236193-47236215
Sequence TACCCTATCCTGCTGTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930053690_930053693 -10 Left 930053690 2:47236193-47236215 CCTGTGAACAGCAGGATAGGGTA No data
Right 930053693 2:47236206-47236228 GGATAGGGTACTTTCTGGGCCGG No data
930053690_930053694 -2 Left 930053690 2:47236193-47236215 CCTGTGAACAGCAGGATAGGGTA No data
Right 930053694 2:47236214-47236236 TACTTTCTGGGCCGGAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930053690 Original CRISPR TACCCTATCCTGCTGTTCAC AGG (reversed) Intergenic
No off target data available for this crispr