ID: 930055200

View in Genome Browser
Species Human (GRCh38)
Location 2:47246525-47246547
Sequence CTGGGGATATGCAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930055200_930055208 22 Left 930055200 2:47246525-47246547 CCTTCCTCACTGCATATCCCCAG No data
Right 930055208 2:47246570-47246592 ATAAATATTTCTGGAATGAAGGG No data
930055200_930055206 13 Left 930055200 2:47246525-47246547 CCTTCCTCACTGCATATCCCCAG No data
Right 930055206 2:47246561-47246583 TAGAGCTCAATAAATATTTCTGG No data
930055200_930055207 21 Left 930055200 2:47246525-47246547 CCTTCCTCACTGCATATCCCCAG No data
Right 930055207 2:47246569-47246591 AATAAATATTTCTGGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930055200 Original CRISPR CTGGGGATATGCAGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr