ID: 930058076

View in Genome Browser
Species Human (GRCh38)
Location 2:47267299-47267321
Sequence CCACGTTGTAAGCACCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930058072_930058076 6 Left 930058072 2:47267270-47267292 CCCTACTCATTAGTTCATATATT No data
Right 930058076 2:47267299-47267321 CCACGTTGTAAGCACCTTAAGGG No data
930058073_930058076 5 Left 930058073 2:47267271-47267293 CCTACTCATTAGTTCATATATTT No data
Right 930058076 2:47267299-47267321 CCACGTTGTAAGCACCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930058076 Original CRISPR CCACGTTGTAAGCACCTTAA GGG Intergenic
No off target data available for this crispr