ID: 930058955

View in Genome Browser
Species Human (GRCh38)
Location 2:47272782-47272804
Sequence AACGGTGGAATTGCAGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930058955_930058962 0 Left 930058955 2:47272782-47272804 CCAGTGCCTGCAATTCCACCGTT No data
Right 930058962 2:47272805-47272827 AGACATTCCCTTCTTTGGAGGGG No data
930058955_930058960 -2 Left 930058955 2:47272782-47272804 CCAGTGCCTGCAATTCCACCGTT No data
Right 930058960 2:47272803-47272825 TTAGACATTCCCTTCTTTGGAGG No data
930058955_930058966 8 Left 930058955 2:47272782-47272804 CCAGTGCCTGCAATTCCACCGTT No data
Right 930058966 2:47272813-47272835 CCTTCTTTGGAGGGGTGGAGAGG No data
930058955_930058959 -5 Left 930058955 2:47272782-47272804 CCAGTGCCTGCAATTCCACCGTT No data
Right 930058959 2:47272800-47272822 CCGTTAGACATTCCCTTCTTTGG No data
930058955_930058967 30 Left 930058955 2:47272782-47272804 CCAGTGCCTGCAATTCCACCGTT No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data
930058955_930058961 -1 Left 930058955 2:47272782-47272804 CCAGTGCCTGCAATTCCACCGTT No data
Right 930058961 2:47272804-47272826 TAGACATTCCCTTCTTTGGAGGG No data
930058955_930058963 3 Left 930058955 2:47272782-47272804 CCAGTGCCTGCAATTCCACCGTT No data
Right 930058963 2:47272808-47272830 CATTCCCTTCTTTGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930058955 Original CRISPR AACGGTGGAATTGCAGGCAC TGG (reversed) Intergenic