ID: 930058956

View in Genome Browser
Species Human (GRCh38)
Location 2:47272788-47272810
Sequence ATGTCTAACGGTGGAATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930058956_930058963 -3 Left 930058956 2:47272788-47272810 CCTGCAATTCCACCGTTAGACAT No data
Right 930058963 2:47272808-47272830 CATTCCCTTCTTTGGAGGGGTGG No data
930058956_930058966 2 Left 930058956 2:47272788-47272810 CCTGCAATTCCACCGTTAGACAT No data
Right 930058966 2:47272813-47272835 CCTTCTTTGGAGGGGTGGAGAGG No data
930058956_930058961 -7 Left 930058956 2:47272788-47272810 CCTGCAATTCCACCGTTAGACAT No data
Right 930058961 2:47272804-47272826 TAGACATTCCCTTCTTTGGAGGG No data
930058956_930058967 24 Left 930058956 2:47272788-47272810 CCTGCAATTCCACCGTTAGACAT No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data
930058956_930058962 -6 Left 930058956 2:47272788-47272810 CCTGCAATTCCACCGTTAGACAT No data
Right 930058962 2:47272805-47272827 AGACATTCCCTTCTTTGGAGGGG No data
930058956_930058960 -8 Left 930058956 2:47272788-47272810 CCTGCAATTCCACCGTTAGACAT No data
Right 930058960 2:47272803-47272825 TTAGACATTCCCTTCTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930058956 Original CRISPR ATGTCTAACGGTGGAATTGC AGG (reversed) Intergenic