ID: 930058957

View in Genome Browser
Species Human (GRCh38)
Location 2:47272797-47272819
Sequence AAGAAGGGAATGTCTAACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930058957_930058969 29 Left 930058957 2:47272797-47272819 CCACCGTTAGACATTCCCTTCTT No data
Right 930058969 2:47272849-47272871 TCTTATTGGTTATTACGGTAAGG No data
930058957_930058967 15 Left 930058957 2:47272797-47272819 CCACCGTTAGACATTCCCTTCTT No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data
930058957_930058966 -7 Left 930058957 2:47272797-47272819 CCACCGTTAGACATTCCCTTCTT No data
Right 930058966 2:47272813-47272835 CCTTCTTTGGAGGGGTGGAGAGG No data
930058957_930058968 24 Left 930058957 2:47272797-47272819 CCACCGTTAGACATTCCCTTCTT No data
Right 930058968 2:47272844-47272866 TCAACTCTTATTGGTTATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930058957 Original CRISPR AAGAAGGGAATGTCTAACGG TGG (reversed) Intergenic