ID: 930058958

View in Genome Browser
Species Human (GRCh38)
Location 2:47272800-47272822
Sequence CCAAAGAAGGGAATGTCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930058958_930058966 -10 Left 930058958 2:47272800-47272822 CCGTTAGACATTCCCTTCTTTGG No data
Right 930058966 2:47272813-47272835 CCTTCTTTGGAGGGGTGGAGAGG No data
930058958_930058969 26 Left 930058958 2:47272800-47272822 CCGTTAGACATTCCCTTCTTTGG No data
Right 930058969 2:47272849-47272871 TCTTATTGGTTATTACGGTAAGG No data
930058958_930058968 21 Left 930058958 2:47272800-47272822 CCGTTAGACATTCCCTTCTTTGG No data
Right 930058968 2:47272844-47272866 TCAACTCTTATTGGTTATTACGG No data
930058958_930058967 12 Left 930058958 2:47272800-47272822 CCGTTAGACATTCCCTTCTTTGG No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930058958 Original CRISPR CCAAAGAAGGGAATGTCTAA CGG (reversed) Intergenic