ID: 930058964

View in Genome Browser
Species Human (GRCh38)
Location 2:47272812-47272834
Sequence CTCTCCACCCCTCCAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930058964_930058967 0 Left 930058964 2:47272812-47272834 CCCTTCTTTGGAGGGGTGGAGAG No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data
930058964_930058968 9 Left 930058964 2:47272812-47272834 CCCTTCTTTGGAGGGGTGGAGAG No data
Right 930058968 2:47272844-47272866 TCAACTCTTATTGGTTATTACGG No data
930058964_930058969 14 Left 930058964 2:47272812-47272834 CCCTTCTTTGGAGGGGTGGAGAG No data
Right 930058969 2:47272849-47272871 TCTTATTGGTTATTACGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930058964 Original CRISPR CTCTCCACCCCTCCAAAGAA GGG (reversed) Intergenic