ID: 930058967

View in Genome Browser
Species Human (GRCh38)
Location 2:47272835-47272857
Sequence GCGATGTCTTCAACTCTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930058957_930058967 15 Left 930058957 2:47272797-47272819 CCACCGTTAGACATTCCCTTCTT No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data
930058965_930058967 -1 Left 930058965 2:47272813-47272835 CCTTCTTTGGAGGGGTGGAGAGG No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data
930058958_930058967 12 Left 930058958 2:47272800-47272822 CCGTTAGACATTCCCTTCTTTGG No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data
930058964_930058967 0 Left 930058964 2:47272812-47272834 CCCTTCTTTGGAGGGGTGGAGAG No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data
930058955_930058967 30 Left 930058955 2:47272782-47272804 CCAGTGCCTGCAATTCCACCGTT No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data
930058956_930058967 24 Left 930058956 2:47272788-47272810 CCTGCAATTCCACCGTTAGACAT No data
Right 930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930058967 Original CRISPR GCGATGTCTTCAACTCTTAT TGG Intergenic