ID: 930062056

View in Genome Browser
Species Human (GRCh38)
Location 2:47298250-47298272
Sequence ACTATATATGGTCTAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930062049_930062056 23 Left 930062049 2:47298204-47298226 CCAGCACCACGACAGTTTACAAA No data
Right 930062056 2:47298250-47298272 ACTATATATGGTCTAAAAGCAGG No data
930062054_930062056 -2 Left 930062054 2:47298229-47298251 CCATGGCAACATCAGGGAGTTAC No data
Right 930062056 2:47298250-47298272 ACTATATATGGTCTAAAAGCAGG No data
930062048_930062056 26 Left 930062048 2:47298201-47298223 CCACCAGCACCACGACAGTTTAC No data
Right 930062056 2:47298250-47298272 ACTATATATGGTCTAAAAGCAGG No data
930062050_930062056 17 Left 930062050 2:47298210-47298232 CCACGACAGTTTACAAATGCCAT No data
Right 930062056 2:47298250-47298272 ACTATATATGGTCTAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930062056 Original CRISPR ACTATATATGGTCTAAAAGC AGG Intergenic