ID: 930062553

View in Genome Browser
Species Human (GRCh38)
Location 2:47302447-47302469
Sequence CTTGGCAAGGGAAAGGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930062547_930062553 -2 Left 930062547 2:47302426-47302448 CCAGGGGAAAGGAAAAGCATTCT No data
Right 930062553 2:47302447-47302469 CTTGGCAAGGGAAAGGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930062553 Original CRISPR CTTGGCAAGGGAAAGGTTAT GGG Intergenic
No off target data available for this crispr