ID: 930065501

View in Genome Browser
Species Human (GRCh38)
Location 2:47324558-47324580
Sequence TGGTCTTGATCCTAAGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930065496_930065501 8 Left 930065496 2:47324527-47324549 CCTTAGGCACTGGGGGGCAATAT No data
Right 930065501 2:47324558-47324580 TGGTCTTGATCCTAAGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930065501 Original CRISPR TGGTCTTGATCCTAAGACAG TGG Intergenic