ID: 930072296

View in Genome Browser
Species Human (GRCh38)
Location 2:47376548-47376570
Sequence GGAACATCAAGGCTCGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930072296_930072303 13 Left 930072296 2:47376548-47376570 CCTCACCCGAGCCTTGATGTTCC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 930072303 2:47376584-47376606 GCAGGTTATGCATTTTTGACAGG 0: 1
1: 1
2: 18
3: 71
4: 321
930072296_930072300 -5 Left 930072296 2:47376548-47376570 CCTCACCCGAGCCTTGATGTTCC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 930072300 2:47376566-47376588 GTTCCCTCTTAACTAAAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930072296 Original CRISPR GGAACATCAAGGCTCGGGTG AGG (reversed) Intronic
900210683 1:1454412-1454434 GCTACATCGAGGCTCGGCTGGGG + Exonic
901343678 1:8519011-8519033 TGAACATCTAGACTCAGGTGTGG - Intronic
902405719 1:16182266-16182288 GGAGCATCCTGGCTGGGGTGAGG + Intergenic
904373115 1:30063189-30063211 GGCTCCTCGAGGCTCGGGTGTGG - Intergenic
905933097 1:41803513-41803535 GGAAAAGCAATGCTGGGGTGTGG - Intronic
907965351 1:59323502-59323524 GGAACATCATTGCTGGTGTGAGG + Intronic
913003410 1:114604490-114604512 GGAACATAAAAGCTGGGCTGTGG + Intronic
917730630 1:177871498-177871520 GGAAAATCCAGGCTCAGGAGAGG - Intergenic
920859301 1:209692460-209692482 GAAACATCAAGGTTGGGGTAAGG + Intronic
1065807675 10:29409874-29409896 GGAACAGGCAGGCGCGGGTGGGG - Intergenic
1067027342 10:42855941-42855963 TGGACACCAAGGCTTGGGTGAGG - Intergenic
1067281951 10:44879871-44879893 GGAATTTGAGGGCTCGGGTGTGG - Intergenic
1069019214 10:63466323-63466345 TGAACATCAAACCGCGGGTGAGG - Intergenic
1069735166 10:70649246-70649268 GGGACCTCCAGGCTCAGGTGGGG + Intergenic
1073057043 10:100709712-100709734 GGAACTGGAAGGCTGGGGTGGGG - Intergenic
1077178570 11:1202416-1202438 GGAACATGGAGGCTCCGGGGAGG - Intergenic
1077406864 11:2386623-2386645 GGAAGACCAAGGCTCAGGTGAGG + Intronic
1080852325 11:36080517-36080539 GGAAAATCAAGCACCGGGTGAGG - Intronic
1082793319 11:57362405-57362427 GGAAAATCAAGGCTTGGGCATGG + Intronic
1083455883 11:62778319-62778341 GGCACCTCAAGGATCGGGTAAGG + Exonic
1083775806 11:64893880-64893902 GGGAAACCAAGGCTCGGGTTGGG - Intergenic
1086013044 11:82128789-82128811 GGAACACCAAAGCTCAGGCGAGG - Intergenic
1090475496 11:127016398-127016420 GGAACACCCAGTCTGGGGTGAGG - Intergenic
1096778120 12:53975981-53976003 AGAACAACTAGGCTCGGGCGGGG - Exonic
1098036841 12:66311905-66311927 GGAACATGGAGACTCAGGTGAGG + Intronic
1100736902 12:97545346-97545368 GGAACATCATGGAGCTGGTGAGG + Intergenic
1103133552 12:118488672-118488694 GGAACTGCAAGGCTCGGGCCAGG - Intergenic
1103897935 12:124286303-124286325 GGGACATCCAGTCTGGGGTGGGG - Intronic
1115204524 14:30887495-30887517 GTAATATTAAGGCTGGGGTGAGG - Intronic
1118065913 14:62190012-62190034 GAAACATCAAGGCTATGGGGGGG - Intergenic
1119343009 14:73896762-73896784 GGAAGAGCAAGGCTTGGGGGAGG + Intronic
1120106397 14:80500442-80500464 GGAACATGAAAGCTGGGGTTTGG - Intronic
1121881358 14:97503195-97503217 GGAACATTAAGGCAGGGGTTGGG - Intergenic
1123427003 15:20180797-20180819 CGGACACCAAGGCTTGGGTGAGG - Intergenic
1123536232 15:21187306-21187328 CGGACACCAAGGCTTGGGTGAGG - Intergenic
1128312296 15:66638641-66638663 GGAGCATCAAGGCCGGGGCGTGG + Intronic
1134291471 16:12905223-12905245 AGAAAATCATGGCTCAGGTGAGG + Intronic
1134858180 16:17537866-17537888 GGAACATCAAGGCAGGTGGGAGG - Intergenic
1135758676 16:25118786-25118808 GGAGCACCAAGACTAGGGTGAGG + Intronic
1139670732 16:68491159-68491181 GGAACAGCCAGGTGCGGGTGGGG + Intergenic
1142147123 16:88497377-88497399 GGAACATCAGGGCCCGGGCGGGG + Intronic
1142717467 17:1754918-1754940 GGGACACCTAGGCTAGGGTGGGG + Exonic
1143512262 17:7403476-7403498 GGGACTTCAAGGGTGGGGTGGGG - Intronic
1144958205 17:19030291-19030313 GGAAAAACAAGGCTGGGGTGGGG + Intronic
1144976953 17:19144233-19144255 GGAAAAACAAGGCTGGGGTGGGG - Intronic
1148784913 17:50141268-50141290 GGAACACCAAGGGCCGAGTGCGG - Exonic
1149650541 17:58273504-58273526 GGAACATGAAGGGTTGGATGAGG + Exonic
1150975141 17:70077459-70077481 TGAACATCAAGGCTGTGCTGAGG + Intronic
1151476636 17:74347883-74347905 AGAACATTAAGACTAGGGTGAGG + Exonic
1151678051 17:75609979-75610001 AGAAAAGCAAGGGTCGGGTGCGG - Intergenic
1156852697 18:41746412-41746434 GGAAGACCAAGGCGCGTGTGGGG + Intergenic
1159890119 18:73945059-73945081 GGAACATCAAGGCAGGGGAGAGG - Intergenic
1166009935 19:39934722-39934744 GGACCATGAAGGCTGAGGTGGGG + Intergenic
925012626 2:496967-496989 GGATCAGCAGAGCTCGGGTGAGG - Intergenic
927171675 2:20375421-20375443 GGATCATGGAGGCCCGGGTGAGG + Intergenic
927177320 2:20419757-20419779 GGATCATGGAGGCCCGGGTGAGG + Intergenic
928128740 2:28633848-28633870 GGAACATACAGGTTGGGGTGGGG - Intronic
929641765 2:43587654-43587676 GGGACATAAAGGATGGGGTGAGG - Intronic
930072296 2:47376548-47376570 GGAACATCAAGGCTCGGGTGAGG - Intronic
930274458 2:49295523-49295545 GGAAGATCTAGGCTTGGGTCTGG - Intergenic
932469195 2:71942890-71942912 GAGACATCAAGGCTGAGGTGAGG + Intergenic
933993191 2:87648453-87648475 GGACCAACAGGGCTCTGGTGCGG + Intergenic
936300666 2:111302430-111302452 GGACCAACAGGGCTCTGGTGCGG - Intergenic
936847446 2:116854106-116854128 GGAGCATCCAGGCTGGTGTGTGG - Intergenic
944413523 2:199463289-199463311 GGGACAACAAGGCAAGGGTGGGG + Intronic
947996757 2:234534492-234534514 GGAAGAGCAAGGCTGGTGTGGGG + Intergenic
1172034225 20:32000369-32000391 TGAACATCCAGACTGGGGTGGGG - Exonic
1172042728 20:32057308-32057330 GGAACATGAAGGGCTGGGTGCGG + Intronic
1172703513 20:36866233-36866255 AGAACAACAGGGCTCTGGTGGGG + Intergenic
1175535834 20:59710771-59710793 GGAACATCAAGAAGTGGGTGAGG - Intronic
1179036600 21:37763442-37763464 GCCACATCAAGGCGGGGGTGGGG - Intronic
1183171869 22:36194413-36194435 GGAGCATCAAGGCTGGGAGGAGG - Intronic
1184842301 22:47059110-47059132 AGAACATCAAGGCTCGGCCAGGG + Intronic
1185229965 22:49674127-49674149 GGAACATTCAGGCTGCGGTGAGG - Intergenic
949596241 3:5550275-5550297 GCAACATGAAGACTCGGTTGAGG - Intergenic
954629362 3:52039802-52039824 GGGACACCAAGGCTCGGGGAAGG + Intergenic
955078960 3:55640145-55640167 AGAAAATCAAGGCAAGGGTGTGG - Intronic
960139794 3:114140854-114140876 GGAAGATGAAGCCTCAGGTGTGG + Intronic
962071035 3:132034267-132034289 GGGACAGCATGGCACGGGTGAGG - Intronic
968556782 4:1249627-1249649 GGTAAATCAGGGCTCGGGTGGGG - Intronic
968756032 4:2417200-2417222 GGGAGGTCACGGCTCGGGTGGGG - Intronic
968813948 4:2812242-2812264 GGAACAGGAAGTCCCGGGTGGGG + Intronic
969387110 4:6860048-6860070 GGAATTTCAAGGCTCAGTTGTGG + Intronic
969661571 4:8532658-8532680 GGAACATCAGCACTGGGGTGGGG + Intergenic
970586910 4:17523137-17523159 GGAAGGTCAAGGCTCCAGTGGGG - Intronic
972718802 4:41675451-41675473 GAAAAAGCAAGGCACGGGTGGGG - Intronic
974969234 4:68804243-68804265 GGACAATAAGGGCTCGGGTGTGG - Intergenic
981084448 4:140668762-140668784 GGAACTTCAATACTCTGGTGAGG + Intronic
982306526 4:153937567-153937589 GAAACATCAGGGCTGGGCTGGGG + Intergenic
985663750 5:1170916-1170938 AGAACATCCAGGGCCGGGTGCGG + Intergenic
985888668 5:2699479-2699501 GGAAGACCAAGGCAGGGGTGGGG + Intergenic
992375077 5:76181053-76181075 GTAACACCAAGGCTGGGGTAAGG - Intronic
1000883234 5:166720964-166720986 GGAACCTAAATGCTTGGGTGAGG - Intergenic
1002471307 5:179437788-179437810 AGAGCATCGAGGCTGGGGTGTGG + Intergenic
1006066866 6:31468365-31468387 GGAAAATCAGGGCCCTGGTGGGG - Intergenic
1006633605 6:35446568-35446590 GGAACTTCAAGGCTCGGACCAGG + Intergenic
1012373004 6:98529822-98529844 GGAACCTCCAGGCACAGGTGGGG + Intergenic
1017965190 6:159258215-159258237 GGAACATCTGGGCTGGGCTGGGG + Intronic
1019479725 7:1261056-1261078 GGTTCAGCAAGGCTGGGGTGAGG - Intergenic
1023358565 7:39392711-39392733 GGAACATGGAGGCTCAGGCGAGG + Intronic
1031484197 7:122308863-122308885 TGAATGTCAAGGCTGGGGTGGGG - Intronic
1035316340 7:157999714-157999736 GAAACATCAAGGTGGGGGTGTGG + Intronic
1036449166 8:8850549-8850571 AGAACACCCAGGGTCGGGTGCGG + Intronic
1038551768 8:28475990-28476012 GGAAGACCAAGGATCTGGTGAGG - Intronic
1044726607 8:95199651-95199673 TGTACACAAAGGCTCGGGTGAGG - Intergenic
1049879352 8:145051862-145051884 GGGACGTGGAGGCTCGGGTGAGG - Intergenic
1052997238 9:34557723-34557745 CGAACATCAAGGGTCAGGTGGGG + Intronic
1056999412 9:91493532-91493554 GGAAGTTCAAGTCTTGGGTGAGG + Intergenic
1060989495 9:127840132-127840154 GGAAAATCAAAGCTCGGAGGTGG + Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1062330988 9:136044888-136044910 TGAACACCCAGGCTTGGGTGGGG - Intronic
1190053821 X:47170682-47170704 GGAAAATCAAGGGTGGGGTCTGG + Intronic
1195016040 X:100781878-100781900 TTAATATCAGGGCTCGGGTGCGG - Intergenic
1197722854 X:129756569-129756591 GAGACATCCAGGCTAGGGTGAGG - Intronic