ID: 930075062

View in Genome Browser
Species Human (GRCh38)
Location 2:47399793-47399815
Sequence GAATCACTTGAAACCAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930075057_930075062 4 Left 930075057 2:47399766-47399788 CCAGCTATTTGGGAGGCTGAGGC 0: 3302
1: 90995
2: 264385
3: 415423
4: 375946
Right 930075062 2:47399793-47399815 GAATCACTTGAAACCAGGGCGGG No data
930075055_930075062 5 Left 930075055 2:47399765-47399787 CCCAGCTATTTGGGAGGCTGAGG 0: 4056
1: 104485
2: 314618
3: 469474
4: 382134
Right 930075062 2:47399793-47399815 GAATCACTTGAAACCAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930075062 Original CRISPR GAATCACTTGAAACCAGGGC GGG Intergenic
No off target data available for this crispr