ID: 930075665

View in Genome Browser
Species Human (GRCh38)
Location 2:47403551-47403573
Sequence CAGGTTCTGCTTGGCTCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930075665 Original CRISPR CAGGTTCTGCTTGGCTCCGG AGG Intronic
900394448 1:2447430-2447452 CAGGTTCTGCTGTGCTCCCAGGG + Intronic
902111124 1:14079120-14079142 CAGTATCTGCTTGGCTTCTGGGG + Intergenic
902235438 1:15054347-15054369 CTACTTCTGATTGGCTCCGGGGG - Intronic
902409599 1:16205313-16205335 CAGGGGCTGCTTGGCTCCTGAGG - Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907454112 1:54564376-54564398 CAGGTTCAGGTTGCCTGCGGGGG + Intronic
907784203 1:57595895-57595917 CAGCATCTGCTTGGCTTCTGGGG - Intronic
908880812 1:68730401-68730423 TGGCTTCTGCTTGGCTCCTGGGG - Intergenic
909931436 1:81503623-81503645 CAGGTCCTGCTGTACTCCGGGGG + Intronic
914754322 1:150554194-150554216 CAGCTTCCGCTTGGCACCTGAGG + Intronic
915118227 1:153613257-153613279 CAGGTTCTGCTCAGCCCCTGCGG - Intergenic
915554410 1:156653345-156653367 CGGGTTCTCCTGGACTCCGGAGG - Intronic
916352742 1:163870396-163870418 CAGCATCTGCTTGGCTTCGGCGG + Intergenic
917806749 1:178620747-178620769 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
920509802 1:206542445-206542467 CAGCATCTGCTTGGCTTCTGGGG - Intronic
920913298 1:210237188-210237210 GATGTTGTGCTTGGCTCCTGTGG + Intronic
920972513 1:210754698-210754720 CAGCATCTGCTTGGCTTCTGGGG - Intronic
922807872 1:228399976-228399998 GATGTTCTGCTGGGCTCCAGAGG + Intronic
923707618 1:236357551-236357573 CAGCATCTGCTTGGCTTCTGGGG + Intronic
924181408 1:241442373-241442395 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
1062895822 10:1102479-1102501 CAGCATCTGCTTGGCTTCTGGGG + Intronic
1063571145 10:7215580-7215602 CAGGTTCTGATTGCCTAGGGAGG - Intronic
1065049124 10:21772856-21772878 CAGCATCTGCTTGGCTTCTGGGG + Intronic
1067077676 10:43197427-43197449 CACGTTCTGGTTGGCGCCGCTGG - Intronic
1069381197 10:67844517-67844539 CAGCATCTGCTTGGCTACTGGGG - Intergenic
1070778077 10:79121708-79121730 AAGGTTCTGCTTGGCATGGGTGG + Intronic
1070977103 10:80614240-80614262 CAGCATCTGCTTGGCTTCCGGGG + Intronic
1070994336 10:80762776-80762798 CAGGTTATACTTGGCTCAGCTGG + Intergenic
1071242818 10:83727253-83727275 CAGCATCTGCTTGGCTTCTGGGG - Intergenic
1071876201 10:89846048-89846070 CTGGTTCAGCTTGGGTCAGGTGG - Intergenic
1072362880 10:94677083-94677105 CAGCATCTGCTTGGCTTCTGGGG - Intergenic
1075927724 10:126266695-126266717 CAGCTTCTGCTCGGCTTCTGAGG + Intronic
1076005330 10:126944238-126944260 CAGGGGCTGCTGGTCTCCGGTGG + Intronic
1076634936 10:131875823-131875845 CAGGCCCTGCGTGGCTCCTGGGG - Intergenic
1076670814 10:132120292-132120314 CTGGGTCTGCTTGGGTCCTGCGG + Intronic
1076751560 10:132546013-132546035 CAGGTCCTGCTTGTGTACGGGGG + Intronic
1077311815 11:1892132-1892154 CAGTTTCTCCTTGGATCTGGGGG - Exonic
1078473931 11:11614230-11614252 CAGCATCTGCTAGGCTCCTGGGG + Intronic
1081243171 11:40731448-40731470 CAGCATCTGCTTGGCTTCTGGGG - Intronic
1082074246 11:47963968-47963990 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
1084088624 11:66866120-66866142 CAGGTTCTGCCTGGTGCCTGGGG - Intronic
1084763777 11:71294254-71294276 CAGGTTCTCCCTGGCTGTGGGGG + Intergenic
1086908869 11:92449363-92449385 CAGATGCTGCTTGGGTCAGGGGG - Intronic
1087671398 11:101111520-101111542 AAAGTTCTGCTTGGCTCAGAGGG - Intronic
1088567004 11:111183076-111183098 CAGCATCTGCTTGGCTTCTGGGG - Intergenic
1090746638 11:129710696-129710718 CAGGTGCAGCCTGGCTTCGGTGG - Intergenic
1094653492 12:32399687-32399709 CAGGTTCGGCGCGACTCCGGGGG - Intronic
1094703874 12:32896612-32896634 CAGCTTCAGCTTGGCCTCGGAGG + Exonic
1100139499 12:91599651-91599673 CAGCATCTGCTTGGCTTCTGGGG - Intergenic
1102366289 12:112338733-112338755 CAGCATCTGCTTGGCTTCTGGGG + Intronic
1104352045 12:128053242-128053264 GAGTTCCTGCTTGGCTCCTGGGG + Intergenic
1104434596 12:128745787-128745809 GAGGTTTTCCTTGGCTCTGGAGG - Intergenic
1104676369 12:130714755-130714777 CAGGGTCTGACCGGCTCCGGAGG - Intronic
1104952391 12:132447447-132447469 CAGGTTCTGCGTGACTCCAAAGG - Intergenic
1105205643 13:18221372-18221394 CAGGGACTGCTTGCCTCCCGAGG - Intergenic
1105899017 13:24741035-24741057 CAGGTTCTGCCTGGGTCCCTGGG + Intergenic
1106851152 13:33793947-33793969 CAGCATCTGCTTGGCTTCTGAGG - Intergenic
1109166490 13:59041372-59041394 CAGGATCTGCTTGGCTTCTGGGG + Intergenic
1109220925 13:59640107-59640129 CAGCTTCTGCTTGGCTTCTGTGG - Intergenic
1112636003 13:101218801-101218823 CAGCATCTGCTTGGCTCCTGGGG - Intronic
1115454007 14:33580576-33580598 CTGGTTCTGCATTGCCCCGGGGG - Intronic
1115623814 14:35169474-35169496 AAGGTTCTGCATGGCTGGGGAGG + Intronic
1115972645 14:38963037-38963059 CAAGGTCTGCTTGGCTTCTGGGG - Intergenic
1120819171 14:88896237-88896259 CAGCTTGTGCTTTGCTCCTGTGG - Intergenic
1122414907 14:101544758-101544780 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
1122598816 14:102910707-102910729 CAGGCTCTGCTTGGCCACCGGGG - Exonic
1123006218 14:105325071-105325093 CAGGTGCTGCCTGTGTCCGGGGG - Intronic
1125752503 15:42037984-42038006 CAAGTTTTGCTTGGGTCCGCTGG - Intronic
1126266082 15:46755745-46755767 CAGCATCTGCTTGGCTTCTGCGG + Intergenic
1128572102 15:68741239-68741261 CATGTCCTGCTTTGCTCAGGTGG + Intergenic
1128841550 15:70854497-70854519 CTGTTTGTGCTTGACTCCGGGGG + Intronic
1129467180 15:75730770-75730792 CAGGCTCTGGCTGGGTCCGGGGG + Intergenic
1132716351 16:1292009-1292031 CAGTATCTGCTTGGCTTCTGGGG - Intergenic
1132740825 16:1412128-1412150 CAGGTTCTACTTGCTTCCTGTGG - Intronic
1133801700 16:9090703-9090725 CGGGTTATCCTTGGCTCCGCGGG + Intergenic
1136066067 16:27759720-27759742 CAGGCTCTGCTTGCCTCACGTGG + Intronic
1137487793 16:48906232-48906254 CAAGGACTCCTTGGCTCCGGGGG - Intergenic
1141004115 16:80336316-80336338 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
1141787412 16:86211048-86211070 CAGACTCTGCCTGGCTCAGGAGG - Intergenic
1142178493 16:88655992-88656014 CAGGCTTTGCTTGGCTCCTGGGG - Intronic
1142995061 17:3755236-3755258 CAGGTGCTGCTCGGCGCCGTCGG - Exonic
1143999281 17:11037691-11037713 CAGCCTCTGCTTGGCTTCTGGGG + Intergenic
1144839377 17:18176266-18176288 CAGCATCTGCTTGGCTTCTGTGG + Intronic
1149281658 17:55111693-55111715 CAGCATCTGCTTGGCTTCTGGGG - Intronic
1150191059 17:63239818-63239840 CAGCTTCTGCTTGGCTTCTGAGG + Intronic
1151382226 17:73733826-73733848 CAGGTTCTGTTTGGGTCCCTTGG - Intergenic
1151894218 17:76969282-76969304 GAGGTTCTGATTAGCTGCGGAGG + Intergenic
1151971463 17:77459608-77459630 CAGCATCTGCTTGGCTTCTGGGG + Intronic
1153345549 18:4021478-4021500 CAGCATCTGCTTGGCTTCTGGGG - Intronic
1159593869 18:70363663-70363685 CAGGCTCTGTTTGGCTCATGTGG - Intergenic
1159681609 18:71360209-71360231 GAGTCTCTGCTTGGCTCCAGTGG + Intergenic
1160420467 18:78740463-78740485 CAGCTGCTGCTTGGCCCAGGGGG - Intergenic
1162958863 19:14114524-14114546 CAGGATCTGCTTGTGTCCTGGGG + Intronic
1163782424 19:19257521-19257543 CGGGTTCTGCTGGCCTCCTGAGG + Exonic
1164398830 19:27889013-27889035 CAGGTCCTGCCTGGCTCTGAAGG + Intergenic
1164523824 19:28999169-28999191 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
1164748638 19:30634812-30634834 CTGGCTCTGCTTGGCTCAGAAGG - Intronic
1165058453 19:33193840-33193862 CAGGTCTTGCTTGGCACAGGGGG + Intronic
1165384947 19:35504867-35504889 CAGCTGCTGCTTGGCCCAGGTGG - Intronic
1166325037 19:42044209-42044231 CAGGTTCAGCATGGCTGGGGAGG - Intronic
1168215587 19:54923017-54923039 CTGGTTCTGCTCGGCTCCCACGG - Intergenic
925122663 2:1431352-1431374 CAGGATCTGCTTGGCTTCTGGGG - Intronic
925819410 2:7785260-7785282 CAGGTTCTGCTTGGATGTGTGGG + Intergenic
928519134 2:32071103-32071125 CATGTTCTGCATGGCTCCTGTGG + Intronic
928687333 2:33762149-33762171 CAGCTTCGGCTTGGCATCGGAGG + Intergenic
930075665 2:47403551-47403573 CAGGTTCTGCTTGGCTCCGGAGG + Intronic
933732277 2:85466199-85466221 CAGCTTCTGCTTGCCTTCTGGGG + Intergenic
933975598 2:87506913-87506935 CTGGCTCTGCTGGGCTCCTGAGG - Intergenic
935059293 2:99593778-99593800 CTGGTTTTGGTGGGCTCCGGGGG + Exonic
935686363 2:105687544-105687566 AAGGTTCTGCAGGGCTCCTGTGG - Intergenic
937146111 2:119646341-119646363 CAGCTTCTGCTTGGCTTCTGCGG + Intronic
937222361 2:120349141-120349163 CAGGTTCTGGTTGCCTTCGTTGG - Exonic
937335231 2:121058462-121058484 CTGATTCTGTTTGGCTCCTGAGG + Intergenic
937930768 2:127203423-127203445 CATCTTCTGCCTGGCTCCTGAGG + Exonic
937995217 2:127689415-127689437 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
938836069 2:135105269-135105291 CAGGTTCGGCTTGGCATCAGAGG - Intronic
940694500 2:156961515-156961537 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
943481835 2:188428671-188428693 CAGCATCTGCTTGGCTTCAGGGG - Intronic
945333991 2:208570250-208570272 CAATTTCTGCTTAGCTCAGGAGG + Intronic
945893071 2:215450807-215450829 CAGCATCTGCTTGGCTTCTGGGG - Intergenic
946299106 2:218811651-218811673 CATGCTCTGCTTGGCTCAGTGGG - Intronic
946948896 2:224850864-224850886 CAGTTTCTGCATGGCTGAGGAGG - Intronic
947260514 2:228216720-228216742 CAGTATCTGCTTGGCTTCTGGGG - Intergenic
947989224 2:234473801-234473823 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
948241871 2:236444682-236444704 CAGGTTCTGTTTGGCCCCAGAGG - Intronic
1169680335 20:8204651-8204673 CAGCATCTGCTTGGCTTCTGGGG - Intronic
1169880262 20:10340063-10340085 CAGCCTCTGCTTGGCTTCTGGGG + Intergenic
1172637486 20:36419771-36419793 CAGCTTCTGCTTTGCTCCCTTGG - Intronic
1173791953 20:45833836-45833858 CGGGTTCTGCAGGGCTCCGCCGG - Exonic
1174444075 20:50578850-50578872 CAGCATCTGCTCGGCTCCTGGGG + Intronic
1175340029 20:58222648-58222670 CAGGTGCTGCCTGGTTCCGGAGG - Intronic
1176043640 20:63081289-63081311 CAGGTTCTGCAGGGCTTCAGAGG - Intergenic
1176179402 20:63742330-63742352 CAGGCTCTGCCTGCCTCCTGCGG - Exonic
1176515914 21:7783286-7783308 CAGCTTCTCCTTGTCTCCTGTGG + Intergenic
1177531452 21:22363476-22363498 AAGGCTCTGCTTAGCTTCGGTGG + Intergenic
1178568675 21:33713740-33713762 GAGGTTCTCCTTGGCTCCTAAGG - Intronic
1178649942 21:34413298-34413320 CAGCTTCTCCTTGTCTCCTGTGG + Intergenic
1179136117 21:38681444-38681466 CAGCATCTGCTTGGCTTCTGGGG - Intergenic
1180760323 22:18197343-18197365 CAGGGACTGCTTGCCTCCCGAGG + Intergenic
1180770636 22:18381641-18381663 CAGGGACTGCTTGCCTCCCGAGG + Intergenic
1180775346 22:18427353-18427375 CAGGGACTGCTTGCCTCCCGAGG - Intergenic
1180808417 22:18738407-18738429 CAGGGACTGCTTGCCTCCCGAGG - Intergenic
1180828579 22:18884599-18884621 CAGGGACTGCTTGCCTCCCGAGG + Intergenic
1181071344 22:20343372-20343394 CAGGGACTGCTTGCCTCCCGAGG - Intergenic
1181194417 22:21172322-21172344 CAGGGACTGCTTGCCTCCCGAGG - Intergenic
1181215025 22:21320456-21320478 CAGGGACTGCTTGCCTCCCGAGG + Intergenic
1181803163 22:25360207-25360229 CAGGACCTCCTTGGCTCCTGTGG + Exonic
1182116680 22:27760683-27760705 CGGGCTCTGCGTGGCCCCGGTGG - Intronic
1182644506 22:31797275-31797297 ATGGTTCTGCATGGCTCAGGAGG + Intronic
1182997536 22:34827923-34827945 CAGCTTCTGCATGGTTCTGGTGG + Intergenic
1183424941 22:37734434-37734456 GGGGCTCTGCTTGGCTCCGCCGG - Exonic
1184040346 22:41939403-41939425 CAGGCTCTGGATGTCTCCGGAGG - Intronic
1185176480 22:49330191-49330213 CTGGTTCTCCTTGGCTGCAGTGG + Intergenic
1203232471 22_KI270731v1_random:122813-122835 CAGGGACTGCTTGCCTCCCGAGG + Intergenic
952416175 3:33093193-33093215 CTGGATCTGCTTGGCTGGGGTGG - Exonic
953312887 3:41896888-41896910 GAGATTCAGCTTGGCTCGGGAGG + Exonic
953313745 3:41906442-41906464 CAGGACCTCCTTGGCTCCAGTGG - Intronic
953878177 3:46678265-46678287 CAGGTACTGCTCGGGTCTGGTGG + Exonic
954148576 3:48646402-48646424 CAGCTTCTGCTGGGCTGCTGAGG + Intronic
954602792 3:51883835-51883857 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
954927881 3:54253337-54253359 CGGATTCTGCTTGGCTTCTGGGG + Intronic
960924585 3:122781513-122781535 CAGCTTCGGCTTGGCACCAGAGG + Intronic
963982300 3:151552240-151552262 CAGTTTCTGCATGGCTGGGGAGG - Intergenic
966475613 3:180341832-180341854 CAGCTCCTGGTTGGCTCCTGGGG + Intergenic
968765842 4:2468763-2468785 CGGGGCCTGCTCGGCTCCGGAGG + Intronic
968810772 4:2798815-2798837 CAGGTGCTGGGTGGCTCAGGTGG + Intronic
969924560 4:10574214-10574236 CAGGTTGTGCTGAGCTCTGGGGG - Intronic
970088204 4:12371556-12371578 CAGCATCTGCTTGGCTTTGGGGG - Intergenic
972041890 4:34612806-34612828 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
974887649 4:67840219-67840241 GAGGTCCTGCATGGCTGCGGAGG + Intronic
977183141 4:93902677-93902699 CAGCTTCTGCTCGGCTTCTGGGG - Intergenic
979198106 4:117943977-117943999 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
980287832 4:130804493-130804515 CAGCTTTTGCTTGGCTTCTGGGG + Intergenic
984193614 4:176633307-176633329 CAGGCTCTCCTTGGCTCCAAAGG + Intergenic
989150049 5:38290344-38290366 CAGCTTGTGCTTGGCTACTGTGG - Intronic
990439560 5:55831364-55831386 CAGGTTGTGTTTGGATCTGGTGG + Intergenic
991961689 5:72051112-72051134 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
992448370 5:76854052-76854074 CAGCATCTGCTTGGCTTCTGGGG - Intronic
993455876 5:88126358-88126380 CAGCTTCTGCTCGGCTTCTGAGG - Intergenic
994520978 5:100834832-100834854 CAGCATCTGCTTGGCTTCTGGGG - Intronic
995460764 5:112400444-112400466 CAGCATCTGCTTGGCTTCTGGGG + Intronic
995629304 5:114116139-114116161 CACTTTCTACTTGGCTCCAGTGG - Intergenic
995641713 5:114264802-114264824 CATCTTCTGCTTTGCTCCGTAGG + Intergenic
997759665 5:136433052-136433074 CAGGTGCTTCTTGGCTCTTGTGG - Intergenic
997934093 5:138095751-138095773 CAGGCTCTGCTTGCCTTCAGTGG - Intergenic
998327152 5:141291339-141291361 CAGGATCTGCTTGGTTTCTGGGG + Intergenic
998711718 5:144833439-144833461 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
998903315 5:146878267-146878289 CGGGTTCTGCGAGGCTGCGGCGG + Intronic
1000011700 5:157239320-157239342 CACGTCCTGTTTGGCTCCAGTGG - Intronic
1000103679 5:158038505-158038527 TAGGTTCTGCATGGCTGGGGAGG - Intergenic
1000660091 5:163927763-163927785 CTGGATCTGCTTGGCTTCTGGGG + Intergenic
1001460237 5:171905693-171905715 CATGCTCTGCATGGCTCCTGAGG - Intronic
1001987350 5:176086009-176086031 CAAGTTCTGCTTGGCCCCCAAGG - Intronic
1002229518 5:177752133-177752155 CAAGTTCTGCTTGGCCCCCAAGG + Intronic
1002265827 5:178031640-178031662 CAAGTTCTGCTTGGCCCCCAAGG - Intronic
1003082812 6:3035698-3035720 CAGCATCTGCTTGGCTTCTGGGG - Intergenic
1003259158 6:4500885-4500907 CTGGGTCTGCTTGGCTTCTGTGG + Intergenic
1005684392 6:28238671-28238693 CCGGCTCTGCTTGGCTTCTGGGG + Intergenic
1006235981 6:32632864-32632886 CAGGTTCAGCTTTTCTCAGGTGG - Intronic
1009622820 6:66097542-66097564 CAGTTTCTGCTTGGCATCAGAGG + Intergenic
1014740895 6:125146739-125146761 CAGCATCTGCTTGGCTTCCGAGG - Intronic
1014867827 6:126553530-126553552 CAGGTTCTGCTTTGCTCCTTTGG + Intergenic
1014937418 6:127400537-127400559 CAGCTTCTGCTTGGCTTCTGTGG + Intergenic
1016117918 6:140312092-140312114 ACAGTTCTGCATGGCTCCGGAGG + Intergenic
1016210968 6:141532470-141532492 CAAGTTTTGCTTGGGTCCGCTGG - Intergenic
1016417136 6:143844545-143844567 AAGGATCTCGTTGGCTCCGGTGG - Exonic
1017190975 6:151652302-151652324 CAGCTTCTGCTTGGCTTCTGGGG + Intergenic
1017496496 6:154988308-154988330 CGGCTTCTGCTTGGCTTCTGGGG + Intronic
1017742131 6:157416018-157416040 CAGGTTCTGCTTGGCCTCCCAGG - Intronic
1017810478 6:157980765-157980787 AGTGTTCTGCTTGGCTCTGGGGG + Intergenic
1018945146 6:168342736-168342758 CAGGCCCTGCTTGGCTCCCCTGG + Intergenic
1019927483 7:4202880-4202902 CAGGTTCACCTTGGGTCTGGTGG + Intronic
1020224221 7:6267165-6267187 CAGCATCTGCTCGGCTCCTGGGG - Intronic
1021780800 7:24103722-24103744 CAGGATCAGCTTGGATCCAGGGG - Intergenic
1023512811 7:40971102-40971124 CAGCATCTGCTTGGCTGCCGGGG + Intergenic
1023637566 7:42227983-42228005 CAGGTTCTGGTTTCCTCCGACGG + Intronic
1026140922 7:67705910-67705932 CAGGTTCTGCTTCTCTCCACTGG + Intergenic
1027501031 7:78951375-78951397 CACGTTCTGCATGGCTGGGGAGG + Intronic
1027710934 7:81600545-81600567 CAGCATCTGCTTGGCTTCGGGGG - Intergenic
1028961268 7:96751943-96751965 CAGGTTCTGCTTGGCCATCGGGG + Intergenic
1029440664 7:100585151-100585173 CAGTTTCTGCTTTCCCCCGGGGG - Intronic
1029603347 7:101583083-101583105 CATGGTCTGCTGGGCTCCTGGGG - Intergenic
1030188750 7:106790022-106790044 CAGTATCTGCTTGGCTTCTGTGG - Intergenic
1031749885 7:125558257-125558279 CAGATTCTACTTGGCTTCTGGGG + Intergenic
1032080668 7:128856977-128856999 CTGGTGCTGCTTTGCTCCAGAGG + Intronic
1034929214 7:155147996-155148018 TGGCTTCTGCTTGGCTCCTGGGG - Intergenic
1037344133 8:17880098-17880120 CTGGTTCCTCTTGGCTCCAGAGG + Intronic
1038963461 8:32547947-32547969 CAGGCGCTGCCTGGCTGCGGAGG + Intronic
1039287865 8:36062099-36062121 CAGCATCTGCTTGGCTTCTGGGG - Intergenic
1039535944 8:38312755-38312777 CAGTATCTGCTTGGCTTCTGAGG - Intronic
1039915729 8:41859024-41859046 CAGGTTCAGCTTGGTGCCGCAGG + Intronic
1040829870 8:51664656-51664678 CAGCTGCTGCTTGACTCTGGGGG + Intronic
1041437896 8:57862280-57862302 CAGTTTCTGCATGGCTGTGGAGG - Intergenic
1043865026 8:85364959-85364981 CAGCTGCCGCTTGGCTCTGGAGG + Intronic
1048203067 8:132392764-132392786 CAGGTTCTGCTTTGTTCCCAAGG - Intronic
1048804346 8:138225955-138225977 CAGGTTCTGCTAGGCCCCTATGG - Intronic
1053503355 9:38620724-38620746 CGGGTTCTCCTGGGCTCCCGCGG + Intergenic
1055482743 9:76725957-76725979 CAGGCTCTTCTTGGCTTCTGTGG - Intronic
1056500652 9:87205359-87205381 CAGGTTCTGCTGGACTTAGGAGG - Intergenic
1057458014 9:95232053-95232075 CAGCATCTGCTTGGCTTCCGGGG + Intronic
1059343420 9:113612531-113612553 CAGCTTCTGCTGGGGTCAGGAGG + Intergenic
1062637441 9:137498945-137498967 CAGGATCTGCTTTGCACAGGAGG + Intronic
1186679894 X:11861917-11861939 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
1189973296 X:46439384-46439406 CAGCATCTGCTTGGCTTCTGGGG - Intergenic
1191826764 X:65374721-65374743 TAGGTTCTGCAGGGCTCGGGAGG + Intronic
1192563129 X:72140506-72140528 CAGCTTCTTCCTGGCTCTGGAGG - Exonic
1195227496 X:102813426-102813448 CAGGATCTGCTTGGCTTCTAGGG + Intergenic
1197041929 X:121947858-121947880 CAGCATCTGCTTGGCTTCTGGGG + Intergenic
1197661460 X:129178532-129178554 CAGGTCCTGCATGGGTCCAGAGG + Intergenic
1197884274 X:131201681-131201703 GTGGTTCTGTTTGGCTCCGAAGG + Intergenic
1199998019 X:153038957-153038979 CAGTTCCTCCTTGGCTCCTGTGG - Intergenic
1200747712 Y:6917043-6917065 GAGGTTCTCCTTGGCACTGGTGG - Intronic
1200787895 Y:7274940-7274962 CAGGAGCAGCTGGGCTCCGGGGG + Intergenic
1200833710 Y:7712374-7712396 CATGTTCTGCTGGGCTTTGGAGG - Intergenic
1200948464 Y:8868722-8868744 CAGGTTTTACATGGCTCTGGTGG - Intergenic