ID: 930086287

View in Genome Browser
Species Human (GRCh38)
Location 2:47499644-47499666
Sequence CATCAGTTCTATAGGACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 2, 1: 19, 2: 62, 3: 94, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930086287 Original CRISPR CATCAGTTCTATAGGACAAC TGG (reversed) Intronic
900731208 1:4261907-4261929 CATTAGTTGTATGGGACAAAGGG + Intergenic
902500351 1:16907006-16907028 CAGCAGTTCTGCAGGACCACAGG + Intronic
902964482 1:19989421-19989443 CATCAGTTCTACAGGACAATTGG - Intergenic
904368266 1:30031976-30031998 CATCACTTCTATGGGACAGTTGG - Intergenic
909044731 1:70695887-70695909 CATCAGTTCTATGAGACAATTGG + Intergenic
910124692 1:83827576-83827598 CATCAGTTCTTTAAGCCAAATGG + Intergenic
913147219 1:116003837-116003859 CATCAGCTCTTTGGGACAATTGG - Intronic
913656022 1:120960601-120960623 CATCAGTTCTATGGGACAATTGG - Intergenic
914520579 1:148411833-148411855 CATCAGTTCTATGGGACAATTGG - Intergenic
914821290 1:151105917-151105939 GATCATTTCTATAAGAAAACAGG - Intronic
915338055 1:155159155-155159177 CCACAGTTCCATAGGGCAACAGG + Intergenic
915710173 1:157889669-157889691 CAAGAGTTCTATTGCACAACAGG + Intronic
916456039 1:164971957-164971979 CATCAGTACAAAAAGACAACTGG - Intergenic
918361608 1:183764580-183764602 CATCACTTCTATGGGACAATTGG + Intronic
918362187 1:183770883-183770905 GATCAGTTCTATGAGACAATTGG + Intronic
918697895 1:187566984-187567006 CATGAGTTCTATGCGACAATGGG - Intergenic
921000212 1:211036433-211036455 CATAAGTTCTACAGGACAATTGG + Intronic
921277120 1:213531608-213531630 CAGCAGTTCTCCAGGACAGCTGG + Intergenic
921796100 1:219346493-219346515 CATCAGTTCTATGGGAAAATAGG + Intergenic
924374313 1:243389313-243389335 CATCAGTTCTTCACAACAACAGG + Intronic
1062785770 10:263471-263493 CAGCAATTCTATGGGACAACTGG + Intergenic
1063289382 10:4728016-4728038 CATCAGTTCCATGGGACAATTGG + Intergenic
1063535932 10:6883531-6883553 CATCAGTTCTATAGGGAAATTGG - Intergenic
1063759209 10:9053159-9053181 CATCAGTCCTATGGGACAATTGG + Intergenic
1065171200 10:23031620-23031642 CATCACTTCTCAAGGACATCAGG - Intronic
1065344628 10:24737122-24737144 TATCAGTTCTGTGGGACAATTGG - Intergenic
1065623677 10:27609178-27609200 CACAAGTTCTATAGGTCAACTGG - Intergenic
1066254390 10:33664413-33664435 TATCATTTCTATGGGACAATTGG - Intergenic
1066256835 10:33687902-33687924 CAGCAATTCTATGGGACAATGGG - Intergenic
1066279156 10:33898351-33898373 CATCAGTTCTGTGGGACAATTGG - Intergenic
1066619020 10:37324650-37324672 CATCAGTCCTATTCGACCACTGG - Intronic
1067988588 10:51182371-51182393 CAACAGTTCCAAAGGCCAACAGG + Intronic
1068097690 10:52512267-52512289 CATCAGCTCTATGGGGCAATTGG + Intergenic
1068189169 10:53627855-53627877 CATCAGTTCTATGGGGAAATTGG - Intergenic
1068290441 10:54995569-54995591 CATCAGTTCTACGGGACAGTTGG - Intronic
1068291272 10:55004348-55004370 CATCAGTTCTATGAAACAATTGG - Intronic
1068409289 10:56634452-56634474 CATCAGCTCTATGGGACAACTGG + Intergenic
1070854754 10:79598267-79598289 CATCAACTCTATGAGACAACTGG + Intergenic
1071056132 10:81510157-81510179 CATCAGCTCTATAGGATAACTGG - Intergenic
1072302425 10:94074103-94074125 TATCATTTCTATGGGAAAACTGG + Intronic
1073765382 10:106676710-106676732 CATCAGTTCTATGGGACAGTTGG - Intronic
1073951304 10:108812769-108812791 CATCAGTTCTATAGGGAAACTGG + Intergenic
1074934126 10:118160541-118160563 CATCATTTCTACAGAAGAACTGG - Intergenic
1075425830 10:122341169-122341191 CCACAGTTCTGTAGGATAACAGG + Intergenic
1077625876 11:3770818-3770840 CATCAGTTCTATAATCAAACTGG + Intronic
1079641235 11:22808044-22808066 CATCAGTTCTATGGGACACTTGG + Intronic
1080315268 11:30940126-30940148 CATAAGTTCTATGGGATAATTGG - Intronic
1081082465 11:38758954-38758976 CATCAGTTTTATGAGACAATTGG + Intergenic
1081131315 11:39383607-39383629 CATCAGTTCTCTGGGACAATTGG + Intergenic
1081383920 11:42448311-42448333 CATCAGTTTTGTGGGATAACTGG + Intergenic
1081943415 11:46965083-46965105 CATCAGTTCTATGGGACAAGTGG + Intronic
1083521688 11:63319669-63319691 CATCAGTTCTATGGGACAATTGG + Intronic
1083893808 11:65610433-65610455 GATAAGTGCTTTAGGACAACTGG - Intronic
1084101188 11:66950810-66950832 CTTCAGTTCCATAAGACAAGTGG + Intronic
1085925087 11:81008829-81008851 AATGAGTTCTATCAGACAACTGG - Intergenic
1087137892 11:94739232-94739254 CATGAGTTCCAGAGGACAAATGG + Intronic
1090099563 11:123779695-123779717 CATCAGTTCTATGGGACAATTGG + Intergenic
1091254202 11:134169389-134169411 CATCAGTCTTATAAGACCACTGG - Intronic
1091899372 12:4132781-4132803 CATCAGTTCAGTAGTAGAACTGG - Intergenic
1092591995 12:9960663-9960685 TATTAGTTCTATAAGATAACGGG - Intronic
1094301484 12:28969523-28969545 CATCTGTTCTCCAGGACATCAGG + Intergenic
1094432909 12:30389383-30389405 CATCAGTTCTATGGAACAATTGG - Intergenic
1094434140 12:30402510-30402532 CATCAGTTCAATAGGACAGTTGG - Intergenic
1094582932 12:31751013-31751035 CATCACCTCTACAGGACAATTGG + Intergenic
1095280678 12:40349173-40349195 CATCAGATCTATGGGACAAAAGG - Intronic
1097556025 12:61138711-61138733 CATCAGTTTTATAAGACAATTGG + Intergenic
1099066023 12:77980267-77980289 CGTCAGTTCTATGGGACAATTGG + Intronic
1099177826 12:79442187-79442209 CATCAGTCCCAAAGAACAACTGG + Intronic
1099873935 12:88381824-88381846 CATCAATTCTACGGGACAATTGG + Intergenic
1100291718 12:93221540-93221562 CATCAGTTCTATGGGACAATTGG - Intergenic
1100326480 12:93544401-93544423 TATCATTTCTATGGGACAATTGG + Intergenic
1100365901 12:93920299-93920321 CATTATTTCCATATGACAACTGG - Intergenic
1102880169 12:116478782-116478804 CATCAGTTCTATAGGACAATTGG + Intergenic
1104126054 12:125847274-125847296 CATCAGTTCTATGGGACAATTGG - Intergenic
1104328628 12:127823821-127823843 CATCAGTTCTGTGGGACTATTGG - Intergenic
1104651843 12:130540391-130540413 CGTCAGTTCTACAGGACAACTGG - Intronic
1105772410 13:23625203-23625225 CATCATTTTTAAAGGACACCTGG + Intronic
1106095800 13:26641856-26641878 CACCAGTTCTGTGGGACAACTGG + Intronic
1106387340 13:29300967-29300989 CATCAATTCTGTAAGATAACTGG + Intronic
1106798560 13:33232647-33232669 TATCATTTCTATGGGACAATTGG - Intronic
1108871567 13:54993315-54993337 CATCAGCTCTATAGGACAACTGG - Intergenic
1109119068 13:58430430-58430452 CATTAGTTCTATGAGATAACTGG + Intergenic
1109428988 13:62207433-62207455 CATCAATTCTATGGGACAACTGG - Intergenic
1109591903 13:64495720-64495742 CATCAGTTCTATGGGAGAGTTGG - Intergenic
1111220415 13:85197752-85197774 CATTAGTTCTATGGGACAATTGG + Intergenic
1111244317 13:85515659-85515681 TATCAGTTCTTTGGGACAATTGG - Intergenic
1111349566 13:87009614-87009636 CATCAGTTCTATGGGACAACTGG - Intergenic
1111456258 13:88487914-88487936 TATCAGTTCTATGGGATAATTGG - Intergenic
1111456633 13:88492956-88492978 CATCAGTTCTATGGGACAATTGG - Intergenic
1111462083 13:88558541-88558563 CATCAATTCTATGGGAGAATTGG + Intergenic
1111525782 13:89467150-89467172 CGGCAGTTCTATGGGACAATTGG + Intergenic
1111538957 13:89646498-89646520 CATCAGTTCTTTGGGACAATTGG - Intergenic
1111608059 13:90566003-90566025 CATCAGTTCCATGGGACAACTGG - Intergenic
1112838280 13:103544605-103544627 CATCAGTTCTATGAGACAAATGG - Intergenic
1113341429 13:109429941-109429963 CATCAGTTCTATGAGATAATTGG + Intergenic
1114922746 14:27354584-27354606 CATCAGTCTTCTAGGAAAACAGG - Intergenic
1115408136 14:33042060-33042082 TATCAGTTCTATGGGGCAATTGG + Intronic
1116389364 14:44374682-44374704 CATCACTTCTATGGGACAGTTGG - Intergenic
1117320276 14:54615484-54615506 CATCAATTCTAAAGGACCACAGG - Intronic
1119614233 14:76088102-76088124 CCTCAGTTCTTTAGGATATCAGG + Intergenic
1119698136 14:76730468-76730490 CATCAGTTCCATGGAACAATTGG + Intergenic
1123453267 15:20387809-20387831 CATCAGTTCTATAGGACAATTGG + Intergenic
1123777923 15:23598851-23598873 TATCAGTTCTATGGGACAATTGG + Intronic
1124091655 15:26609870-26609892 CAACAGTTCTATGGGACAATTGG - Intronic
1124486297 15:30120142-30120164 CATCAGTTCTATAGGACAATTGG + Intergenic
1124541372 15:30589127-30589149 CATCAGTTCTATAGGACAATTGG + Intergenic
1124548023 15:30650625-30650647 CATCAGTTCTATAGGACAATTGG + Intronic
1124757286 15:32418460-32418482 CATCAGTTCTATAGGACAATTGG - Intergenic
1124937375 15:34186052-34186074 CATCACTTCTATGGGACAATTGG + Intronic
1127252233 15:57251593-57251615 CATCTGTTCTTTGGGACATCAGG + Intronic
1129588556 15:76893548-76893570 GAACAGTTCTATAGGCCAAATGG + Intronic
1130018426 15:80205495-80205517 TATCAGTTCTATGGGACAACTGG - Intergenic
1130718166 15:86357176-86357198 CATCAGCCCTCTAGGACCACAGG - Intronic
1131738634 15:95362140-95362162 TGTCACTTCTATGGGACAACTGG - Intergenic
1131939587 15:97546178-97546200 CATCAGTTCTATGGGAAAATTGG + Intergenic
1132017924 15:98335480-98335502 CATCACCTCTATGGGACAATTGG - Intergenic
1134560122 16:15201774-15201796 CATCAGTTCTATGGGACAATTGG + Intergenic
1134597294 16:15506091-15506113 CATCAGTTCTAAGGGGCAATTGG - Intronic
1134772461 16:16821609-16821631 TATCAGTTCTATGGGATAATTGG + Intergenic
1134920661 16:18113384-18113406 CATCAGTTCTATGGGACAATTGG + Intergenic
1135923584 16:26672864-26672886 CAGCAGTTCTAAGGGGCAACAGG + Intergenic
1135947121 16:26875043-26875065 CATCAGGTCTAGGGGACAATAGG - Intergenic
1135947201 16:26875592-26875614 CATCAGTTCTGTGGGACACTTGG + Intergenic
1138719879 16:59067643-59067665 CATCAGTTCTGTGGGACAATTGG + Intergenic
1140239503 16:73188443-73188465 CATCAGCTCGAGAGGACAAAGGG - Intergenic
1142299830 16:89250166-89250188 CATCACTTCTATGGGACAATTGG - Intergenic
1143327693 17:6110179-6110201 CATCAGTTCCTAAGGTCAACAGG - Intronic
1143604597 17:7975238-7975260 CATCAGTTCCAAGGGACAGCTGG + Intergenic
1149270890 17:54976327-54976349 TATCAGTTCTATGGGACAATTGG - Intronic
1152832584 17:82507510-82507532 AAACAGTTCTATAGGAAAATTGG - Intergenic
1153597156 18:6739128-6739150 CACCAGTTCTAGAGGAGACCGGG - Intronic
1153954295 18:10083219-10083241 CATCAGTTCTATGGAACAACTGG + Intergenic
1154295570 18:13144043-13144065 CATCAGTTTTATGGGACAATTGG + Intergenic
1155230050 18:23763978-23764000 CATTCCTTCTGTAGGACAACTGG + Intronic
1155689457 18:28600833-28600855 CATCAGTTCTCTGGGACAGTTGG - Intergenic
1156645724 18:39159990-39160012 TACAAGTTCTATGGGACAACTGG + Intergenic
1156788466 18:40943822-40943844 TATCAGCTCTATGGGACAACTGG + Intergenic
1159198471 18:65149921-65149943 TATCAGATCTATGGGACAACTGG + Intergenic
1159327248 18:66938211-66938233 CATCAGTTCTATGGGACAATTGG - Intergenic
1159741554 18:72177254-72177276 CATCAGTTCTATGGGACAATTGG + Intergenic
1164537886 19:29099887-29099909 CATCAGTTCTATGGGAAAATTGG - Intergenic
1164586825 19:29480913-29480935 CATCAGTTCTATGGGGAACCTGG - Intergenic
1168538024 19:57187718-57187740 CATCAGTTCTATGGGACAACTGG - Intergenic
925838622 2:7969633-7969655 CATCATTTTTATAAGACAAAAGG + Intergenic
926345901 2:11944675-11944697 CATCAATTCTATGGGACAATTGG + Intergenic
926353725 2:12020902-12020924 CATCAGTTCTATGGAGCAATTGG - Intergenic
926482033 2:13411425-13411447 CATCAGTTCTATAGGACAATTGG - Intergenic
927905580 2:26853554-26853576 TATCAGTTCTCCAGGATAACTGG + Intronic
928346350 2:30500778-30500800 AATCAGTTCTATGGGACAAGTGG - Intronic
928697969 2:33869643-33869665 CATCAGTTCTATGGGACAATTGG + Intergenic
928838775 2:35580053-35580075 CATCAGTTCTACCAGACAATCGG + Intergenic
929138660 2:38648446-38648468 CATTAGTTGTATGGGACAATTGG + Intergenic
929307617 2:40381623-40381645 CATCTGTTCTATAGGACAGCTGG - Intronic
930086287 2:47499644-47499666 CATCAGTTCTATAGGACAACTGG - Intronic
931152704 2:59592650-59592672 CATCAGTTCTATTGGACAATTGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933549924 2:83763327-83763349 CATCAGTTCTATGGGACAATTGG + Intergenic
933792811 2:85896716-85896738 TATCAGTTCTATGGGACAATTGG + Intergenic
935765693 2:106365479-106365501 CATCAGTTCTATGGGACAATTGG + Intergenic
935794492 2:106628215-106628237 CATCAGCTCTACAGGAAAAATGG - Intergenic
935865199 2:107380541-107380563 CATCAGCTCTATAGGACAACTGG - Intergenic
936919331 2:117671430-117671452 TATCAGTTCTATGGGACACTTGG + Intergenic
937783292 2:125864988-125865010 TATCAGTTCTATGGGACGATTGG + Intergenic
938175858 2:129128137-129128159 CATCAGCTCTATGGGACAATTGG - Intergenic
938176305 2:129134254-129134276 CATCAGCTCTATGGGACAATTGG - Intergenic
938708380 2:133953780-133953802 CATCAGTTCTGTGGGACAGTTGG - Intergenic
940492826 2:154386550-154386572 CATCAGTTCTGTGGGACAATTGG + Intronic
940493307 2:154392576-154392598 CATCACTTCTGTGGGACAATTGG + Intronic
940832630 2:158484396-158484418 CTTCAGTTCTCAAGGACAAGTGG - Intronic
941196773 2:162462009-162462031 CATCATTTCTACAGGACCCCTGG - Intronic
943024020 2:182607319-182607341 TATCAGTTCTATAGGACAATTGG + Intergenic
943341507 2:186687732-186687754 TATCAGTTCTATGGGACAATTGG - Intergenic
943444008 2:187960206-187960228 CATCAGTTCTATGGGACAATTGG + Intergenic
943551050 2:189339944-189339966 CATCAGTTCTATGGGACAACTGG + Intergenic
943551443 2:189345240-189345262 CATCAGTTCTATGGAACAATTGG + Intergenic
945303068 2:208232321-208232343 CATTAGTTCTATGGGACAATTGG + Intergenic
945367025 2:208966684-208966706 CCTCAGCTCTATGGGACAATTGG + Intergenic
945493689 2:210484449-210484471 CATCAGTTCTATGGGACAATTGG - Intronic
945614613 2:212052588-212052610 CATCATTTCTATTGGACAACTGG - Intronic
946938021 2:224742116-224742138 TATTAGTTCTATGGGACAATTGG - Intergenic
947483079 2:230521205-230521227 GATCAGTTCTATGGGACAGTTGG - Intronic
948432482 2:237928681-237928703 CATCAGTTCTATGGGACAATCGG + Intergenic
948817216 2:240518120-240518142 CATCAGTTCTATGGGACAATTGG - Intronic
948880457 2:240854664-240854686 CATCCGTTCTATGGGACAATTGG + Intergenic
949071973 2:242030850-242030872 CATCAGTTCTATGGGACAATCGG + Intergenic
1169043045 20:2511449-2511471 CATCAATTCTGTGGGACAATTGG + Intronic
1169337867 20:4771934-4771956 CATCAGCTCTATGGGACAACTGG - Intergenic
1170429894 20:16266290-16266312 CATCAGTTCTATGGGACCACTGG + Intergenic
1170812563 20:19686068-19686090 CATCAGTTCTATGGGACAGTTGG + Intronic
1171022548 20:21599353-21599375 CATCAATTCTATGGGACAATTGG + Intergenic
1171357755 20:24563281-24563303 TATCAGTTCTATGGGATAATTGG - Intronic
1172719341 20:36987366-36987388 CATCAGTTCTATGGGACAATTGG - Intergenic
1174085189 20:48002927-48002949 CATCAGCTCTATGGGACATTTGG + Intergenic
1174137725 20:48392421-48392443 CATCAGTTCTATGGGACAATTGG + Intergenic
1174787771 20:53448551-53448573 CATCAGTTCTATCAGATAATTGG + Intronic
1174788402 20:53454714-53454736 CATCCATTCTATGGGACAATTGG - Intronic
1177967536 21:27746736-27746758 CACCAGTTCTATGGGACAATTGG + Intergenic
1178317226 21:31576731-31576753 CAAGAGTTCCATAGGAAAACTGG - Intergenic
1179076677 21:38128827-38128849 CATCAGTTATATAGGAAAGTTGG - Intronic
1179285051 21:39970051-39970073 CTTCAGTTCTATAGGAAAATTGG - Intergenic
1179330530 21:40396767-40396789 CATTAATTCTATAGGACAGTTGG - Intronic
1182702041 22:32248245-32248267 CATCAGTTCTATGGGACAACTGG - Intronic
949439077 3:4061177-4061199 CATCAGTGCTATGGGACAATTGG - Intronic
950153296 3:10704815-10704837 CAACAGATTTATATGACAACAGG + Intronic
950254652 3:11494487-11494509 CATCGGTTCTATGGGACAGCTGG + Intronic
951021308 3:17783424-17783446 CATCAGTTCTATGGAACAATTGG + Intronic
951536982 3:23749270-23749292 CATCCGTTCTATGGGAATACTGG + Intergenic
953089730 3:39713055-39713077 CATCAGTTCCGTGGGACAATTGG + Intergenic
953312480 3:41892580-41892602 CATCAGTTCTATAGGACAATTGG - Intronic
953654336 3:44837132-44837154 CATCAGTTCTAGGGGACAGTTGG + Intronic
954892694 3:53945893-53945915 CATCAGTTCTATGGGACAATTGG - Intergenic
955331118 3:58048273-58048295 CACCAGTTCTACAAGACAACGGG - Intronic
956245676 3:67180338-67180360 CATGAGTACTTTAGGAGAACAGG - Intergenic
958120852 3:89286171-89286193 CATCAGTTCTATGGGACCCTTGG + Intronic
958169191 3:89917157-89917179 AATCAGTTCTATAAGACAATTGG + Intergenic
958169707 3:89923173-89923195 CATCAGTTCTCTAGGACAATTGG + Intergenic
959457127 3:106576596-106576618 CATCAGTTATATGGGACAGTTGG - Intergenic
959477798 3:106832574-106832596 CATCAGTTCTATGGGACAACTGG + Intergenic
959504414 3:107142032-107142054 CATCAGTTCTATGGGACAACTGG + Intergenic
961920919 3:130425322-130425344 CCTCTGTTCTAAATGACAACTGG - Intronic
965962843 3:174448995-174449017 CATCAGTTCTATAGGATAATTGG + Intronic
967027289 3:185576039-185576061 CACAAATTCTATAGGAGAACAGG + Intergenic
967162178 3:186748601-186748623 TATCAGTTCTATGGGACAATTGG + Intergenic
967400287 3:189053310-189053332 CATCAGTTCTATGAGAAAATTGG - Intronic
969821392 4:9723231-9723253 GATCAGTTTTATAGGACTAAAGG + Intergenic
970402864 4:15734806-15734828 CATCACTTCTCTGGGACAGCTGG + Intronic
970720297 4:18980575-18980597 CAGCACTTCTATGGTACAACTGG - Intergenic
972533884 4:39983889-39983911 TTTAAGTTATATAGGACAACAGG - Intergenic
972791436 4:42375036-42375058 CATCAGTTCTATGGGAAAACTGG - Intergenic
972791942 4:42381086-42381108 AATCAGTTCTATGGGACAATTGG - Intergenic
974124334 4:57677129-57677151 CATCAGTTCTATGGGACAATGGG - Intergenic
974613509 4:64249410-64249432 CATCAGTTCTTTGGGACAATTGG - Intergenic
977335833 4:95697936-95697958 GATAAATTCTATAAGACAACTGG + Intergenic
979809610 4:125019573-125019595 TATCATTTCTAGGGGACAACTGG + Intergenic
980411074 4:132419751-132419773 CATCAGTTCTATGAGACAAATGG + Intergenic
980655390 4:135776274-135776296 CATCAGTTATATGGGAAAATTGG + Intergenic
981147219 4:141339340-141339362 CATCAGTTCTACGGGACAATTGG - Intergenic
981745014 4:148044506-148044528 CATCAGTTCTGAAGCAGAACAGG - Intronic
982102096 4:151977966-151977988 CATCAGTTCTATAGGACAACTGG + Intergenic
982914657 4:161191415-161191437 CATCAGTTATATCAGACAGCAGG - Intergenic
983140133 4:164140270-164140292 CATCAATTCTATAGGACAATTGG - Intronic
983176727 4:164596893-164596915 CGTCAGTTCTATGGGACAATTGG - Intergenic
984046208 4:174802228-174802250 CATCAGCTCTATGGGAAAATTGG - Intronic
984137523 4:175959541-175959563 CATCAGAGCTTTAGGAGAACTGG + Intronic
984270901 4:177547702-177547724 TATCAGTTCTATGGGAAAATTGG + Intergenic
984328244 4:178280950-178280972 TATCAGTTCTATGGCACAATTGG + Intergenic
984872419 4:184338367-184338389 CATCAGTTCTATGGGAAAATTGG + Intergenic
985245847 4:187979053-187979075 CATCAGTTCTATAAGACAATTGG - Intergenic
985283253 4:188307629-188307651 CTTCAATTATATGGGACAACTGG + Intergenic
986868517 5:12018311-12018333 CATCAATTCCATGGGACAATGGG - Intergenic
986971513 5:13342661-13342683 CATCAGTTATATGGAACAATTGG - Intergenic
987666873 5:20954380-20954402 CATCAGTACTATGGGACAATTGG - Intergenic
988566337 5:32322463-32322485 CATCAGTTTTATAGGACATTTGG + Intergenic
988604251 5:32666440-32666462 CATCAGTTCTGCTGGACCACTGG + Intergenic
990965964 5:61448169-61448191 CATCAGTTCTATGTGACAATTGG + Intronic
991159665 5:63483365-63483387 CATCAGTTCTATGGGACAATTGG - Intergenic
991688063 5:69199771-69199793 CATCAGTTCTGTGGGACAATTGG + Intronic
992308062 5:75464096-75464118 CATCAGTTCTATGGGAAAACTGG + Intronic
992468354 5:77029620-77029642 CATCAGTTCTATAGGACAGTTGG + Intronic
993806830 5:92420830-92420852 GATCAGTTCTACAGGACAATTGG + Intergenic
994595206 5:101823807-101823829 CATCAGCTTGATGGGACAACTGG + Intergenic
994791559 5:104232981-104233003 CATCATTTCTATAGAACAATTGG + Intergenic
996037599 5:118775860-118775882 CATCAGTTCTATGGGCCAGTTGG - Intergenic
996649773 5:125861091-125861113 CACTAGTTCTATGGGACAATTGG + Intergenic
996658315 5:125967954-125967976 CATCAGTTCTATGGAACTACTGG + Intergenic
996915763 5:128710729-128710751 CATCAGTTCTATGGGACAATTGG - Intronic
999645903 5:153716861-153716883 GATCATTTCTATAGGACAAATGG - Intronic
1000814977 5:165909576-165909598 CATCAGTTCTGTGGGACAATTGG + Intergenic
1002473183 5:179449607-179449629 CATCAGTTCTATGGGACAATTGG + Intergenic
1002481039 5:179501046-179501068 CATCAGTTCTATGGGGCAATTGG - Intergenic
1003043368 6:2710297-2710319 CATCAGTTCTGTGGGACAACTGG - Intronic
1003785308 6:9479204-9479226 TATCATGTCTATGGGACAACCGG - Intergenic
1005035195 6:21549541-21549563 TATCAGTTCTGTGGGACAATTGG + Intergenic
1005475706 6:26205559-26205581 CATAACTTCTAAGGGACAACTGG - Intergenic
1005901920 6:30223912-30223934 AATCAGTCCTATGGGACAAATGG + Intergenic
1006224422 6:32524612-32524634 CATCATTTCTAAAGGGCAAACGG - Intronic
1008204906 6:48643102-48643124 CATCTGTTCTATGGGACAACAGG - Intergenic
1008561396 6:52728230-52728252 CATGAAGTCTATGGGACAACAGG + Intergenic
1008863675 6:56183349-56183371 AATCATTTCTATATGACAAAGGG - Intronic
1010989278 6:82461505-82461527 CATCAGTTCTATGGGACAGTTGG - Intergenic
1011008669 6:82678309-82678331 CCTCAGGTCTGTAGGACAATTGG + Intergenic
1011030577 6:82918638-82918660 TATCAGTTCTATGGGACATTTGG - Intronic
1011490071 6:87882577-87882599 CATCAGTTCTCTGGGACAATTGG + Intergenic
1012193397 6:96308883-96308905 CTTAATTTCTATGGGACAACTGG + Intergenic
1012233614 6:96787885-96787907 CATCAGTTATATGGGACAGTTGG - Intergenic
1012368758 6:98477190-98477212 CATCAGCTCTATGGGACAGTGGG - Intergenic
1013076851 6:106779489-106779511 CATCAGTTCTATGGGACAATTGG + Intergenic
1013755042 6:113451686-113451708 CGTCAGCTCTATGGGACAACTGG - Intergenic
1014139847 6:117928876-117928898 TATCAATTCTATGGGACAACTGG - Intronic
1015934447 6:138394455-138394477 CATCAGTTCTATGGCACAGTTGG + Intergenic
1016009052 6:139119650-139119672 CATCTGTTCCATGGGACAACTGG - Intergenic
1016242723 6:141951271-141951293 CATCAGTTCTATGAGACAATTGG - Intergenic
1016656622 6:146525621-146525643 CATCAGTTCCATGGGACACTTGG - Intergenic
1017734236 6:157346430-157346452 CATCAATTTTATAGGAAAGCTGG + Intergenic
1018624210 6:165761926-165761948 CATCAGTTCTATGGGACAATAGG - Intronic
1020581092 7:10003435-10003457 CATCAGTTCTATGGGACAATAGG - Intergenic
1020771258 7:12398214-12398236 GATCAGTTCTGTGGGACAATTGG - Intronic
1022476650 7:30715444-30715466 CTTCAGTTCTATGGGAAAATTGG + Intronic
1024001584 7:45193295-45193317 CATCAGTTCTATGGGACAATTGG + Intergenic
1024654846 7:51442923-51442945 CATCAGTTTTATGGGACAATTGG + Intergenic
1024864503 7:53889130-53889152 CGTCGGTTGTATAGGACAATTGG + Intergenic
1025734412 7:64134379-64134401 CATCATTTCTAGGGGACAATTGG + Intronic
1026160242 7:67862309-67862331 CATCATTTCTAGGGGACAATTGG + Intergenic
1026261112 7:68756197-68756219 CATCGATTCTATGGGACAATTGG + Intergenic
1027625860 7:80544163-80544185 CATCAGTTCTATGGAACAGTTGG + Intronic
1028068017 7:86412847-86412869 CATCAGTTGTATGGAACAATTGG + Intergenic
1029023812 7:97393088-97393110 CATCAGTTCTATGGGGCAATTGG - Intergenic
1033055507 7:138049356-138049378 CATCAGTTCTGTGGGACAATTGG + Intronic
1033094570 7:138419225-138419247 CTTTAGTTCTATGGGAAAACTGG - Intergenic
1034180195 7:149131159-149131181 CATCAGTTCTATAGGGCAATTGG + Intronic
1034233112 7:149548065-149548087 CATCAGTTCTATGGGACAATTGG - Intergenic
1034303023 7:150032732-150032754 CTTCAGTTCTAAAGAACAATAGG + Intergenic
1034327916 7:150254382-150254404 CATCAGTTCTATAGGACAATTGG - Intronic
1034480864 7:151319751-151319773 CATCAGTTATATGGGAAAATTGG + Intergenic
1034765294 7:153715056-153715078 CATCAGTTCTATAGGACAATTGG + Intergenic
1034803025 7:154064536-154064558 CTTCAGTTCTAAAGAACAATAGG - Intronic
1037247363 8:16850616-16850638 CATCACTTCTATGGGACATGTGG - Intergenic
1037527970 8:19746128-19746150 CATCAGTTCTATGGGAAAATTGG + Intronic
1038214174 8:25546496-25546518 CATCAGTTCTATGGGACAATTGG + Intergenic
1038231688 8:25706479-25706501 CATTAGTTCTATGGGACAACTGG - Intergenic
1039269770 8:35868177-35868199 CATCAGTTCTCTGGGACAATTGG + Intergenic
1039287015 8:36052743-36052765 CATCAGTTCCATGGGACAGTTGG + Intergenic
1039290343 8:36087976-36087998 CTTCAGTTCTATGGGACAATTGG + Intergenic
1039389719 8:37168390-37168412 CATCAGTTCTATGGGACATTTGG + Intergenic
1041172351 8:55157089-55157111 CTACAATTCCATAGGACAACTGG - Intronic
1042483883 8:69331150-69331172 CATCAGTTCTACGGGAAAATTGG + Intergenic
1042857921 8:73285977-73285999 CCTCAGTTCCATAGGGCAAGGGG + Intergenic
1042971033 8:74409248-74409270 CATCAGCTTTATGGGACAATTGG - Intronic
1043530735 8:81147269-81147291 GATAAGTTGTATAGGGCAACAGG - Intergenic
1044325595 8:90854175-90854197 CATTAGTTCTATTGGAAAATTGG + Intronic
1044945035 8:97381719-97381741 TATCAGTTCTATGGAACAACTGG + Intergenic
1045012614 8:97971274-97971296 CATCAGTTCTGTGGGACAATTGG + Intronic
1045643000 8:104272583-104272605 TGTTAGTTCTATGGGACAACAGG + Intergenic
1045786302 8:105924961-105924983 TATCAGATCTATAGGATAATTGG + Intergenic
1047307896 8:123668017-123668039 CATCAGTTCTAGGGGACAATTGG + Intergenic
1047671319 8:127150186-127150208 CGTTAGTTCTATGAGACAACTGG + Intergenic
1052176996 9:25474183-25474205 CATCAGTTCTATGGGACAATTGG - Intergenic
1052561712 9:30091747-30091769 CATCAGTTCTGTGGGACAGTTGG - Intergenic
1055367919 9:75565462-75565484 CATCAGTTCTATGGGACAATTGG + Intergenic
1056860860 9:90180377-90180399 CATAAGTTCTATGGGAAAATTGG - Intergenic
1061143337 9:128781456-128781478 TATCAGTTCTGTGGGACAATTGG - Intergenic
1185976155 X:4722835-4722857 CATCAGTTCAATTAGACATCAGG + Intergenic
1187136837 X:16556146-16556168 CATTAGTTCTATGGAACAATTGG - Intergenic
1188182877 X:27077022-27077044 CATCAGTTCTATGGGACAATTGG - Intergenic
1188186353 X:27120270-27120292 CATCAGCTTTATGGGACAATTGG - Intergenic
1188858892 X:35232419-35232441 CATCAGTTCTAAGGGACAATTGG + Intergenic
1188908184 X:35813209-35813231 TATCAGTTCTATGGGACAATTGG + Intergenic
1188908878 X:35821217-35821239 TATCAGTTCTGTGGGACAACTGG + Intergenic
1189407566 X:40738826-40738848 CATCGGTTCTATGGGACAATTGG - Intergenic
1192507278 X:71696099-71696121 CATCAGTTTTATTGAACAAATGG - Intergenic
1192512585 X:71732432-71732454 CATCAGTTTTATTGAACAAATGG + Intergenic
1192514112 X:71749077-71749099 CATCAGTTTTATTGAACAAATGG - Intergenic
1192519418 X:71785453-71785475 CATCAGTTTTATTGAACAAATGG + Intergenic
1192724675 X:73736633-73736655 TATTAGTTCTATAGGACAATTGG - Intergenic
1193184606 X:78497434-78497456 CCTCAGTTCTATTGGACAATAGG - Intergenic
1195472493 X:105246786-105246808 CATCAGTTATATAGGACAACTGG + Intronic
1195481339 X:105349011-105349033 CATCAGTTCTTTTGGACAATTGG + Intronic
1196291932 X:113952026-113952048 CGTCAGTTCTATGGGACAATTGG + Intergenic
1196715245 X:118804817-118804839 CATCAGCTCTGTGGGACAATTGG - Intergenic
1197856047 X:130915098-130915120 CTTCAGGTCTTTAGGGCAACTGG + Intergenic
1201908236 Y:19106682-19106704 CTTGAGTTCTATAAGAAAACAGG + Intergenic