ID: 930090050

View in Genome Browser
Species Human (GRCh38)
Location 2:47525469-47525491
Sequence CCTGGAGTCCAGAGCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930090040_930090050 23 Left 930090040 2:47525423-47525445 CCAGAGTGGAGCATGGTGAGGGT 0: 1
1: 0
2: 0
3: 21
4: 156
Right 930090050 2:47525469-47525491 CCTGGAGTCCAGAGCTGTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 317
930090036_930090050 28 Left 930090036 2:47525418-47525440 CCTACCCAGAGTGGAGCATGGTG 0: 1
1: 0
2: 2
3: 17
4: 163
Right 930090050 2:47525469-47525491 CCTGGAGTCCAGAGCTGTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 317
930090038_930090050 24 Left 930090038 2:47525422-47525444 CCCAGAGTGGAGCATGGTGAGGG 0: 1
1: 0
2: 0
3: 33
4: 223
Right 930090050 2:47525469-47525491 CCTGGAGTCCAGAGCTGTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 317
930090045_930090050 -10 Left 930090045 2:47525456-47525478 CCCGGCAGTGTCCCCTGGAGTCC 0: 1
1: 0
2: 0
3: 27
4: 260
Right 930090050 2:47525469-47525491 CCTGGAGTCCAGAGCTGTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930090050 Original CRISPR CCTGGAGTCCAGAGCTGTGC TGG Intronic
900739462 1:4321966-4321988 CCTGGAGGTCAGAGCAGGGCAGG + Intergenic
901400752 1:9013814-9013836 CCTGGATTCCAGGGCAGCGCCGG - Intronic
902374020 1:16021857-16021879 TGTGGAGGCCAGAGCTGTGCAGG - Intronic
904333799 1:29784361-29784383 CCTGGAGGCCTGGGCCGTGCAGG - Intergenic
904616697 1:31753873-31753895 ACTGGTGCCCAGAGCTGGGCTGG - Intronic
907733532 1:57090023-57090045 ACTTGAGCCCAGAGCTGTGAAGG - Intronic
907733653 1:57091079-57091101 ACTTGAGCCCAGAGCTGTGAGGG + Intronic
908350947 1:63286147-63286169 CCTGGAGTCTAGGGCTGTGAGGG - Intergenic
911091376 1:94019854-94019876 CCTGGAGGCCACACCTGGGCGGG - Intronic
911659718 1:100487756-100487778 CCTGGACTTCAGTGCTGGGCTGG + Intronic
912682967 1:111740399-111740421 CCCGGCGTCCAGGGCTGGGCTGG - Intronic
913114278 1:115682208-115682230 CCTGGAGACCAGAAGTGTGGTGG + Intronic
915951187 1:160190769-160190791 GATGGGGCCCAGAGCTGTGCCGG + Exonic
916487755 1:165274563-165274585 CCTGGAGGCCAGTGCTGGGAAGG - Intronic
916727757 1:167538214-167538236 CCTGGAGACCAGAACTGGGTGGG + Intronic
917301562 1:173580010-173580032 CCTTGAGCCCAGTGATGTGCTGG + Intronic
918474696 1:184911438-184911460 CCTGGTGCCCAGAGCTCTGCTGG - Intronic
919747450 1:201017537-201017559 CCCAGAGCCCAGAGCTGTGACGG + Intronic
920081817 1:203380192-203380214 CCTGGAGTCCAGTGATGTGCTGG + Intergenic
920624250 1:207580395-207580417 CCTGAAGCCCCGAGATGTGCAGG + Exonic
922575201 1:226656451-226656473 CCCGGAAGCCACAGCTGTGCTGG + Intronic
922795803 1:228338844-228338866 CCTGGATCACAGAGCTGGGCAGG - Exonic
923297614 1:232610401-232610423 CCTGGCGTCCAGCCCAGTGCTGG - Intergenic
924213837 1:241798663-241798685 CCTGGTGCCCAGAACAGTGCAGG - Intronic
924704188 1:246485713-246485735 CCAGGAGTCCAAAGCTGTAGTGG + Intronic
1062940030 10:1414101-1414123 GCTGGAGGCCATGGCTGTGCAGG - Intronic
1063134195 10:3202094-3202116 CTTGGAAGTCAGAGCTGTGCTGG + Intergenic
1063159585 10:3409413-3409435 ACTGGAGTTCAGTGCCGTGCTGG + Intergenic
1063160897 10:3417329-3417351 GCTGGAGTCCAGCGCTGTAGCGG + Intergenic
1065864178 10:29899247-29899269 TATGGAGTCCAGAGCTGACCAGG + Intergenic
1067068713 10:43117637-43117659 GATGGTGGCCAGAGCTGTGCTGG - Intronic
1067079569 10:43205506-43205528 CCTGGAGCCCAGGGCTGAGCTGG - Intronic
1067324021 10:45249236-45249258 CAGGGAGTCCTTAGCTGTGCGGG - Intergenic
1067440998 10:46309217-46309239 CCTGGGCCCCAGAGCTGGGCGGG - Intronic
1067524219 10:47028564-47028586 CCTGGAGGTCAGAGGTGGGCAGG - Intergenic
1069910003 10:71753115-71753137 AATGGAGTCCGGAGCTGTGCAGG - Intronic
1072121224 10:92407067-92407089 CTTGGTGCACAGAGCTGTGCTGG + Intergenic
1072656650 10:97334583-97334605 CCTGGCACCCGGAGCTGTGCGGG + Exonic
1072787283 10:98292926-98292948 CCTGTACTCCTGAACTGTGCTGG + Intergenic
1072861233 10:99007246-99007268 CCTGGAGTCTGGGGCTGTGAGGG + Intronic
1073484497 10:103808106-103808128 CCTGGAGTCCTCTGCTCTGCTGG - Intronic
1075088757 10:119431197-119431219 CCTGGGGCCCACAGCTGTCCTGG - Intronic
1075413427 10:122245958-122245980 TCTGGAGCCCAGAGCTGCCCAGG - Intronic
1075731704 10:124640295-124640317 CCTGCCGCGCAGAGCTGTGCAGG - Intronic
1076589619 10:131574121-131574143 GCTGGAGACCAGTGCAGTGCAGG + Intergenic
1076618559 10:131772270-131772292 TGTGGTGTCCAGAGCTGTGTGGG - Intergenic
1076833564 10:133008785-133008807 CCTGGAGTCCAGGAGAGTGCAGG - Intergenic
1076872933 10:133202453-133202475 CCTTGCGTCCAGAGCTCTGCAGG - Intronic
1077109297 11:855052-855074 CCTGGAGCCCACAGCTGGGTAGG - Intronic
1077328996 11:1975809-1975831 TCAGGACCCCAGAGCTGTGCAGG + Intronic
1077828283 11:5834498-5834520 CCTGGTTTCCTGAGCTGTACAGG + Intronic
1077919335 11:6631238-6631260 CTTGGGGCCCAGAGCTGGGCAGG + Intronic
1077936310 11:6790847-6790869 CCTGGAGTCCAAAGCAGTGGTGG - Intergenic
1080280850 11:30554960-30554982 CCCAGATTCCACAGCTGTGCTGG + Intronic
1080433302 11:32217780-32217802 CCTGGAGGACAGAGGTGAGCTGG - Intergenic
1080891580 11:36413196-36413218 CCAGGAGTCCCCAGCAGTGCTGG - Intronic
1081088563 11:38832184-38832206 TCTGGCCTCCAGAGCTGTGAGGG + Intergenic
1081631264 11:44691597-44691619 CCTGGAGTCTGGAGATGTGGGGG + Intergenic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1081987238 11:47314530-47314552 CCAGGAGTTCAGAGCTGTGGTGG + Intronic
1083628015 11:64081904-64081926 CCGGGAGTCCAGAGGGCTGCAGG - Intronic
1083634845 11:64115038-64115060 CCTGGTGTGCAGAGCAGAGCCGG - Intronic
1084362370 11:68677414-68677436 CCTGGAGGCCTGAGCTGTGCAGG - Intergenic
1085417282 11:76327859-76327881 TCTGGTGGCCAGAGCTGGGCTGG + Intergenic
1085717586 11:78886648-78886670 CCTGGAATCCAGGGCTGTCATGG + Intronic
1086550446 11:88046922-88046944 GCTGAAGTGCAGGGCTGTGCAGG + Intergenic
1090345624 11:126067464-126067486 CCAGGAGGCCTGAGCTGCGCAGG - Intergenic
1202811975 11_KI270721v1_random:30988-31010 TCAGGACCCCAGAGCTGTGCAGG + Intergenic
1092526543 12:9313255-9313277 TGTGGAGTCCAGAGCGCTGCCGG + Intergenic
1092911839 12:13152538-13152560 CCTGGAATCCACTGCTGTCCTGG - Intergenic
1096112160 12:49035381-49035403 CCTAGATTCCAGAGCTGTTTTGG + Intronic
1096770732 12:53934451-53934473 CCTGGAGCCCAGAGAAGTGGAGG + Intergenic
1096789408 12:54035613-54035635 CCTGGAGTGCAGAGGCGTGAAGG - Intronic
1097711255 12:62920041-62920063 CCAGGTGTCCAGAACTGGGCTGG - Intronic
1098568567 12:71963017-71963039 CCTGGAATGCAGAGGTGTTCAGG - Intronic
1099026167 12:77467185-77467207 CCTGGAGTACATAGCTGCGAAGG - Intergenic
1099423840 12:82498901-82498923 CATGGAGTCCAGTTCTGTACTGG - Intergenic
1100103147 12:91134306-91134328 CCAGGAGTCAACAGCTGTGAAGG - Intergenic
1103244956 12:119448771-119448793 CCTAGAAACCAGAGCTGTGGTGG + Intronic
1103961747 12:124613277-124613299 CCTGGAGCCCTGAGCTGGGAGGG - Intergenic
1104104271 12:125644318-125644340 CCTGGAGTCCAGATCTTTGTGGG + Intronic
1104358015 12:128105692-128105714 CGTGGGCACCAGAGCTGTGCAGG - Intergenic
1104567181 12:129895554-129895576 CCTGGCAGCCAGGGCTGTGCAGG - Intronic
1104979541 12:132567636-132567658 CCTGGGGTGCAGAGCTGGGTGGG + Intronic
1104987761 12:132606569-132606591 CCCGGAGTCCACAGCTCAGCCGG + Intronic
1105547452 13:21361271-21361293 CCTGCACCCCAGGGCTGTGCAGG + Intergenic
1105962671 13:25356186-25356208 CCTGGAGCCCAGAGTGGGGCAGG + Intergenic
1106810016 13:33350192-33350214 CCTGGAGCCCAGAGCAGAGGAGG + Intronic
1107396645 13:40024993-40025015 CCTGGTGTCCAGTCCTGTGCAGG - Intergenic
1108095755 13:46898749-46898771 CCTGGGATCCAGAGCTGCTCTGG - Intergenic
1108159252 13:47620777-47620799 CCTGGAGGACAGAGTTGGGCAGG + Intergenic
1108173063 13:47763398-47763420 CCAGGCGGCCAGAGCTGTGCAGG - Intergenic
1108267964 13:48731107-48731129 CTGGGTGCCCAGAGCTGTGCTGG + Intergenic
1109722171 13:66288997-66289019 CCTGAACACCAGAGCTGTGGTGG - Intergenic
1113635809 13:111918241-111918263 CCTGGAGTCCTGAGCTACGTGGG - Intergenic
1114346829 14:21805402-21805424 ACTGGAGTGCAGTGGTGTGCTGG - Intergenic
1117036358 14:51733785-51733807 CCTCTAGTCCAGAGCTGCTCAGG + Intergenic
1117329078 14:54694833-54694855 CCTGGAGCACCCAGCTGTGCCGG + Intronic
1118373360 14:65156592-65156614 CCTGGAGGCCAGCGCTTTGCGGG - Intergenic
1118422544 14:65622867-65622889 CCTGGATTCCATCTCTGTGCTGG + Intronic
1118439103 14:65797098-65797120 CCTGCAGTCCAGTGCTAAGCAGG - Intergenic
1120517573 14:85488992-85489014 CCCAGAGTCAAGCGCTGTGCTGG - Intergenic
1121608475 14:95259170-95259192 GCTGGAGCGGAGAGCTGTGCCGG + Intronic
1122276348 14:100592692-100592714 CCTGGAGTCCAGGCCCCTGCAGG - Intergenic
1122978155 14:105179454-105179476 TCTGGTGACCAGAGCTGAGCTGG - Intronic
1123579499 15:21703585-21703607 CCTGGGGGCCTGAGATGTGCAGG + Intergenic
1123616126 15:22146096-22146118 CCTGGGGGCCTGAGATGTGCAGG + Intergenic
1124166474 15:27330454-27330476 CATGGTGTGCAGAGCTCTGCTGG - Intronic
1128760132 15:70210843-70210865 CCTGGTGCCCAGACCTGTACTGG + Intergenic
1129190037 15:73931760-73931782 CCTGGAGGGCAGAGGTGGGCAGG - Intronic
1129343674 15:74902907-74902929 CCTGTAGTCCAGGGATGTGTGGG - Intronic
1129836305 15:78709513-78709535 CCTGGAGACCCGAGCAGGGCGGG - Intronic
1202988369 15_KI270727v1_random:437830-437852 CCTGGGGGCCTGAGATGTGCAGG + Intergenic
1132648127 16:1008360-1008382 TCTGGCCTCCAGAGCTGTGAGGG - Intergenic
1133736205 16:8617710-8617732 CGTGGCCTCCAGAACTGTGCGGG - Intergenic
1133975676 16:10598440-10598462 CCTGGTTTCCAGGGCTGAGCTGG + Intergenic
1134110801 16:11514453-11514475 CGCGGAGTCCAGCTCTGTGCAGG + Exonic
1134798307 16:17061698-17061720 GGTGGAGTCCAGGGTTGTGCAGG + Intergenic
1135844760 16:25908953-25908975 CTTGGTGCCCAGGGCTGTGCTGG + Intronic
1137035387 16:35565478-35565500 CCTGGAGCCAAGACATGTGCGGG - Intergenic
1137566922 16:49539162-49539184 GCTGGTGTCCAGAGCCGTGGGGG - Intronic
1137735757 16:50721902-50721924 CCTGGGGCACAGAGCAGTGCTGG + Intronic
1138198054 16:55068731-55068753 CCTGTAATGCAGAGCTCTGCAGG - Intergenic
1139077295 16:63466705-63466727 CATGGAGGCCAGTTCTGTGCTGG + Intergenic
1139925526 16:70483709-70483731 CCTGGAGCCTGGAGTTGTGCAGG - Intronic
1141593700 16:85085095-85085117 CCTGCTGTGCACAGCTGTGCAGG - Intronic
1142317288 16:89355900-89355922 CCTGGTCTCCCGAGCTGTGCTGG - Intronic
1142317947 16:89361028-89361050 CCTGGAGCCCAGGGCTGCCCAGG - Intronic
1142353087 16:89588642-89588664 CCGGGAGCCAGGAGCTGTGCTGG - Intronic
1142621511 17:1168458-1168480 CTTGGAGCACAGAGCTTTGCAGG + Intronic
1143007808 17:3848217-3848239 CCTGGTGTCCATAGCTGAGGAGG - Intergenic
1143537709 17:7550994-7551016 CCAGGAGGCCAGTGCTGTGTCGG - Intronic
1143584775 17:7845609-7845631 CTTGGGGGCCTGAGCTGTGCTGG + Exonic
1147190666 17:38736201-38736223 CCTGGAGCCCCGAGCTGGCCAGG - Intronic
1147312173 17:39601873-39601895 TCAGAAGTCCAGAGCTGGGCGGG - Intergenic
1147990698 17:44331070-44331092 CCTGGGTCCCAGAGCTCTGCTGG + Intergenic
1148798677 17:50209941-50209963 CCCTGAGCCCAGAGCTCTGCTGG + Intergenic
1149419603 17:56496424-56496446 TCTGGTCTCCAGAGCTGTGAGGG - Intronic
1150437449 17:65165045-65165067 CCTGGAGCCCAGCCCAGTGCTGG - Intronic
1150805052 17:68312169-68312191 CCTGAAGTCCAGAGCTAGGAGGG - Intronic
1151322777 17:73361595-73361617 CCCGGTGTCAAGAGCTGTGCTGG - Intronic
1152003953 17:77665529-77665551 CCTCCAGTGCAGAGCTGTGTGGG + Intergenic
1152065857 17:78112249-78112271 CCTGGAGCCCTGGGCTGTGATGG + Exonic
1152305850 17:79519779-79519801 CCTGGTGTCCAGAGTTTTACTGG - Intergenic
1154377513 18:13822360-13822382 ACTGGAGTCCCAAGCCGTGCTGG - Intergenic
1157057373 18:44246760-44246782 CCTGGAATCCTGGGCTGAGCTGG - Intergenic
1157241253 18:46011449-46011471 CCTGGTGGCCAGGGCTATGCTGG - Intronic
1157620957 18:49017304-49017326 CCAGGCGTGCAGAGCTGAGCAGG - Intergenic
1160099053 18:75903567-75903589 CTTGGGGGCCAGAGCTGTGCTGG - Intergenic
1160852555 19:1199887-1199909 CCTGGAGTGTAGACCTGGGCAGG + Intronic
1160860742 19:1236428-1236450 CCTGGAGCTCAGCGCTGGGCAGG + Intronic
1160965214 19:1744452-1744474 CCTGGCCTCCAGAGCAGAGCTGG + Intergenic
1161730723 19:5959052-5959074 CCTGGACTCCAGAGCAGACCAGG - Intronic
1162814255 19:13183769-13183791 CATGGGGTGCAGAGCTGGGCAGG - Intergenic
1163434701 19:17288523-17288545 GCTGGAGTGCAGTGCTGTGATGG - Intergenic
1163446797 19:17351708-17351730 GCTGGGGCCCAGGGCTGTGCGGG + Exonic
1163552596 19:17973996-17974018 CCTGGAGGCCCGGGCTGTGCGGG - Exonic
1164706889 19:30326342-30326364 TCTGGCATCCAGAGCAGTGCAGG + Intronic
1165039369 19:33058232-33058254 CCTGGAGTGCTGAGCAGTGCTGG - Intronic
1165299094 19:34956794-34956816 TCTGAAGGCCAGTGCTGTGCTGG - Exonic
1166316194 19:41991555-41991577 CCTGGGGTCAAGTCCTGTGCAGG + Intronic
1166953406 19:46445589-46445611 CCTGGAGTTCAGAGATGGGGTGG + Intergenic
1168185784 19:54698554-54698576 CTTAGTGTCCAGAGCTCTGCTGG - Intronic
1168708425 19:58482778-58482800 GCAGGAGGCGAGAGCTGTGCTGG + Intronic
927645161 2:24872859-24872881 TCTGGGGTCCAAGGCTGTGCTGG - Intronic
928169115 2:28992061-28992083 CTTAGTGTCCAGAGCAGTGCTGG + Intronic
929355954 2:41024946-41024968 ATTGAAGTCCAGAGCTGGGCGGG + Intergenic
929595197 2:43171166-43171188 TCTGGTCTCCAGAGCTGTGTGGG + Intergenic
930090050 2:47525469-47525491 CCTGGAGTCCAGAGCTGTGCTGG + Intronic
931516822 2:63054999-63055021 CCTGGAGGCCAGAACTGGGCAGG - Intronic
932010094 2:67967659-67967681 TCTGGAGTGCAGAGCTGTTATGG - Intergenic
935128218 2:100242387-100242409 GCGAGAGGCCAGAGCTGTGCAGG - Intergenic
936624997 2:114139389-114139411 CCTGGAAACCACAGCTGTGTTGG + Intergenic
943190910 2:184679507-184679529 CCGGGAGTGCAGAGATGTCCAGG - Intronic
943557320 2:189421618-189421640 CCTGGAGTCAGGGGCTGTGGGGG - Intergenic
944417060 2:199489471-199489493 GCTGGAGTGCAGTGGTGTGCTGG + Intergenic
945036211 2:205706136-205706158 TCTGGAGTCCAAAGATGTGAGGG + Intronic
946229484 2:218282645-218282667 CCTGGAAGCCAGAGCTGGGTTGG + Intronic
947445817 2:230161781-230161803 CCTGGAGTCCTGTGCTGGGAGGG + Intergenic
947461315 2:230306774-230306796 CCTGCAGGCCAGTGCTGAGCTGG - Intronic
948784714 2:240346333-240346355 ACTCGAGTCCAGAGCAGGGCTGG + Intergenic
1168966154 20:1899336-1899358 CCTGCAGACCAGAGCTTTGCTGG + Intronic
1169296349 20:4403251-4403273 CCTGGGTTTCAGAGCTGTGCAGG + Intergenic
1170476613 20:16721327-16721349 CCTTGAGTTCAGTGCTGTGCTGG + Intergenic
1171204538 20:23268512-23268534 CTGGGTGTCCAGGGCTGTGCTGG - Intergenic
1171982028 20:31635019-31635041 CCTGGAGACCAGAGCTTTCCAGG - Intergenic
1172244773 20:33438386-33438408 CCTGAAGTCAAGAGCTCTCCAGG + Intronic
1172705017 20:36876507-36876529 CCTGGAGAACAGAGCGGGGCAGG + Intronic
1173375013 20:42475219-42475241 CCTGAGGTCCAGAAATGTGCAGG + Intronic
1173631796 20:44521839-44521861 CCTCGAGACCAGAGCTGCACGGG - Intronic
1173718358 20:45231005-45231027 CCTGGAGTCTTGAGGAGTGCAGG + Intergenic
1173795868 20:45859293-45859315 TCTGAAGTCCAGTGCTATGCTGG + Intronic
1173800658 20:45892415-45892437 CCTGGAGTCCCCAGCTGGGGTGG + Exonic
1173839123 20:46145740-46145762 CCTGGAGTCATAGGCTGTGCAGG + Intergenic
1174690828 20:52502742-52502764 CCTGGAGTGGAGAACTGTGCTGG + Intergenic
1175167021 20:57051289-57051311 CCCGGTGCTCAGAGCTGTGCAGG - Intergenic
1175864828 20:62169861-62169883 CCTGGAGTCCCGAGCGCGGCTGG + Intronic
1176019576 20:62955789-62955811 CGTGGAGGCCAGGGCTGTACTGG + Intronic
1176038745 20:63053198-63053220 CCTGGGGCCCAGAGCGGGGCTGG - Intergenic
1176041688 20:63068995-63069017 CCTGGAGCCCAGAGATGCCCGGG + Intergenic
1176055069 20:63141028-63141050 CCAGGAGTGCAGAGCTTTGTGGG - Intergenic
1179467075 21:41582957-41582979 CCTCCAGACCAGAGCCGTGCTGG + Intergenic
1179718446 21:43302112-43302134 CCTGCAGCCCGGAGCTGAGCTGG - Intergenic
1179925371 21:44531279-44531301 ACTGGGCTCCAGAGCTGTGCAGG - Intronic
1180728068 22:17961069-17961091 CCTGGTGTCCCTAGGTGTGCTGG - Intronic
1181155786 22:20919033-20919055 CCTGGAGTTCAGAGATCTGGAGG - Intronic
1181343180 22:22198942-22198964 CCTGGAGCCCAGAGATGGCCAGG - Intergenic
1181368621 22:22398957-22398979 CCTGGAGCCCAGAGATGCTCAGG - Intergenic
1181376900 22:22465875-22465897 CCTGGAGCCCAGAGATGCTCAGG - Intergenic
1181390948 22:22580237-22580259 CCTGGAGCCCAGAGATGGTCAGG - Intergenic
1181412666 22:22735014-22735036 CCTGGAGCCCAGAGATGGTCAGG - Intronic
1181416002 22:22759136-22759158 CCTGGAGCCCAGAGATGGTCAGG - Intronic
1181420292 22:22792928-22792950 CCTGGAGCCCAGAGATGGTCAGG - Intronic
1181509404 22:23382335-23382357 GCTGGAGTCCTGGGCTGAGCTGG - Intergenic
1184671543 22:46014388-46014410 CTTGGGGTCCAGGGCTGGGCAGG - Intergenic
1184720297 22:46308748-46308770 CCTGGGCACCAGAGCTGGGCAGG - Exonic
1185068203 22:48642397-48642419 CCAGGAGTCAGGAGCTGTGGAGG - Intronic
1185345380 22:50308376-50308398 GCTGGAGGCCAGGGATGTGCTGG - Intergenic
950312149 3:11968054-11968076 CCTGGAGCCCACAGTTGAGCTGG + Intergenic
950692311 3:14669642-14669664 GCTGGAGTCCTGGGCTGGGCTGG - Intronic
950775390 3:15345503-15345525 CCTGGAGTCCAGAGGAGAGTGGG + Intergenic
951794573 3:26524110-26524132 TTTGGAGTCAAGAGCTGTGCAGG + Intergenic
952877494 3:37958910-37958932 ACTTGATTCCAGAGCTGAGCTGG - Intronic
952977607 3:38709394-38709416 TCAGGAGGCCAGAGCTGGGCAGG + Intronic
953386237 3:42507528-42507550 GCTGGAGTCCAGCCCTCTGCAGG + Intronic
953409670 3:42683557-42683579 CCTGCAGTCCAGGGCTGGGCTGG + Intergenic
953480343 3:43246143-43246165 AAGGGAGTCCAGAGCTGTCCTGG + Intergenic
953996904 3:47526769-47526791 GCTGGAGTGCAGTGGTGTGCCGG - Intergenic
954320572 3:49829729-49829751 CTGGGTGGCCAGAGCTGTGCAGG - Exonic
954972455 3:54662691-54662713 CCTGGATTCCAGGGCTGTTCAGG + Intronic
955401937 3:58598379-58598401 CCTGGAGACCAGAACTGTAGAGG - Intronic
956805137 3:72802533-72802555 TCTGGAGGCCAGAGGTGTGAAGG - Intronic
957269099 3:78005686-78005708 TCTTGAGTCCAGTGCAGTGCAGG - Intergenic
957545178 3:81627906-81627928 CCTGTAGTCCAGTGCTTTGGAGG - Intronic
958185998 3:90119923-90119945 TCTGGACTCCAGAACTGTGAGGG - Intergenic
959625558 3:108445973-108445995 CCTGGAGTCTGGAGCTGTGGGGG - Intronic
961365425 3:126396358-126396380 CCTGGTTTCCAGAGCTTTGCAGG + Intronic
965734932 3:171810121-171810143 CCTGGAGCGCAGAGCCGCGCAGG - Intronic
967873580 3:194251572-194251594 CAAGGTGCCCAGAGCTGTGCAGG - Intergenic
968036486 3:195552228-195552250 CATGGAGCCCAGCGCTGGGCAGG + Intergenic
968280476 3:197473183-197473205 CCAGGAGTTCTGAGCTCTGCTGG - Intergenic
968285554 3:197506553-197506575 ACTGGGGCCCAGAGCTGGGCTGG - Intergenic
968899484 4:3424440-3424462 CCTGGAGTCCAGAAATCTGCAGG + Intronic
968900480 4:3429196-3429218 CCTGGAGGCCAGGGGTGTGCAGG - Intronic
969254349 4:5992280-5992302 CCTGAGGAACAGAGCTGTGCTGG - Intergenic
969702699 4:8776449-8776471 CCTGGAATGCAGTGCTCTGCTGG + Intergenic
969927397 4:10597743-10597765 CCTGGCCTGCAGAGCTGTGGAGG + Intronic
971351014 4:25855984-25856006 CCTGGGGATCAGAGCTGAGCTGG + Intronic
971511393 4:27429658-27429680 ACTGGAGTCCAGAACTCTGATGG - Intergenic
971513991 4:27464001-27464023 CCTGGAGCCCAGAGCTATCATGG - Intergenic
973986121 4:56355741-56355763 CCTGTAGTCCCAAGCTGTTCAGG - Intronic
975475070 4:74813809-74813831 CCTGGATTCCACACCTCTGCTGG - Intergenic
976521998 4:86039450-86039472 CCTGGTGTCTAGGGCTGTGAGGG - Intronic
978339482 4:107707183-107707205 CCTGAAGCCCAGGGCTGTGTGGG + Intronic
979289439 4:118963888-118963910 CATGGAGGCCACAGCTGTCCTGG + Intronic
980423910 4:132600094-132600116 CCAGGAGGCCAGAGCTGTGCTGG + Intergenic
981171959 4:141636240-141636262 CCTGGAGACCCGGGCTGGGCTGG - Intergenic
982467874 4:155752572-155752594 CCTGCAGCCCAGAGCAGTGAGGG - Intergenic
983526417 4:168764817-168764839 CCTGGAGCCAAGAGAGGTGCGGG - Intronic
987673407 5:21044268-21044290 CCTGGAGTCAGGCGCTGAGCAGG + Intergenic
989983214 5:50667149-50667171 CCAGAAGTCCAGAGCTGAGAAGG + Exonic
991571240 5:68055381-68055403 CCTGGAGTTCACAGCTGCTCTGG + Intergenic
992800515 5:80291394-80291416 CCTATAGTCCCCAGCTGTGCAGG - Intergenic
997779045 5:136638766-136638788 ACTGGAGGCCAAGGCTGTGCAGG - Intergenic
998895723 5:146797877-146797899 CCTGGAGTTCAGAGGTTGGCAGG + Intronic
1000251307 5:159498082-159498104 CAAGGAGCCCAGAGCTGTACAGG + Intergenic
1001328239 5:170744752-170744774 GCTGGAGTCCGGAACTGTGGAGG - Intergenic
1001576140 5:172765242-172765264 CCTCGTTTCCAGAGCTCTGCGGG - Intergenic
1001687115 5:173601987-173602009 CCTGGAGTGCAGGGCTGGGGTGG + Intergenic
1001754662 5:174159289-174159311 CTTGGAGGCCAGAGCAGGGCAGG + Intronic
1002261961 5:177999504-177999526 CTGGGAGTCCAGAGCTGTGAAGG - Intergenic
1003404227 6:5815415-5815437 CCTGCACCCCAGGGCTGTGCAGG - Intergenic
1003525107 6:6890807-6890829 CCTGCAGTCCAAAGCAGAGCAGG + Intergenic
1003828142 6:9975065-9975087 CCTGGAGGCCAGGGATGTGGAGG + Intronic
1004631632 6:17426885-17426907 CCTAGCTTCCAGAGCAGTGCTGG - Intronic
1005057155 6:21740074-21740096 GCTGGAGTCCAGAGCTCTTTAGG + Intergenic
1006814910 6:36843573-36843595 CCTGGAGGACAAGGCTGTGCAGG + Intergenic
1008082576 6:47209728-47209750 TCCGAAGCCCAGAGCTGTGCAGG + Intergenic
1011635843 6:89372280-89372302 CTTGGAGTTCAGAGCGGGGCGGG - Intronic
1012636680 6:101551617-101551639 CCAAGAGTCCAGAACAGTGCGGG - Intronic
1017697651 6:157033891-157033913 CCTGAAGTACAGAGGTGTGAAGG - Intronic
1019190944 6:170250277-170250299 CCTGGAGTCTTGAGGTGTCCAGG - Intergenic
1019666544 7:2254777-2254799 CCTGACACCCAGAGCTGTGCGGG - Exonic
1019997304 7:4733033-4733055 GCAGGAGCCCAGAGCTGTGCAGG - Intronic
1020665925 7:11043947-11043969 GCTGGAAACCAGAGCTCTGCAGG - Intronic
1022478244 7:30726012-30726034 GCTGGAGCCCAGAGCTGTGAGGG + Intronic
1022632097 7:32094922-32094944 GCTAGAGGCCAGAGCTGTGAAGG - Intronic
1023817580 7:43962222-43962244 CCTGGGAGGCAGAGCTGTGCAGG - Intergenic
1023829172 7:44029156-44029178 CCAGAAGTGCAGAGCTGAGCAGG - Intergenic
1024318488 7:48043139-48043161 CCTGGAGACCTGAGCAGTGGAGG + Intronic
1024535040 7:50423359-50423381 TCTGGCCTCCAGAGCTGTGGGGG + Intergenic
1024883416 7:54115169-54115191 CCAGGACAGCAGAGCTGTGCTGG - Intergenic
1025743897 7:64226228-64226250 CCTGGAGTCAAGACATGTGCAGG - Intronic
1025751108 7:64294641-64294663 CCTGGAGTCAAGACATGGGCAGG - Intergenic
1026078585 7:67196867-67196889 CCTGGTGTCCAGAACTCAGCAGG - Intronic
1026513814 7:71049632-71049654 CCTGGAGTCTGGTGCTGTGGGGG - Intergenic
1026698237 7:72615115-72615137 CCTGGTGTCCAGAACTCAGCAGG + Intronic
1028555969 7:92125190-92125212 CTATGAGTCCAGGGCTGTGCTGG + Intronic
1028965110 7:96793557-96793579 ACTGGAGTCTAGAGCTGTCAGGG + Intergenic
1029383177 7:100226557-100226579 CATGGTGACCAGAGCTGGGCAGG - Intronic
1029739474 7:102483413-102483435 CCAGAAGTGCAGAGCTGAGCAGG - Exonic
1029757475 7:102582592-102582614 CCAGAAGTGCAGAGCTGAGCAGG - Exonic
1029775415 7:102681653-102681675 CCAGAAGTGCAGAGCTGAGCAGG - Intergenic
1030766511 7:113416699-113416721 GCTGGAGCCCAGAACTGTGGGGG + Intergenic
1031422210 7:121565794-121565816 GCTGAAGTGCAGGGCTGTGCAGG - Intergenic
1032217471 7:129968860-129968882 CCTGGAGTCCAGTTTGGTGCTGG - Intergenic
1032538517 7:132684478-132684500 CCTAGAGGGCAGTGCTGTGCTGG + Intronic
1034266432 7:149783313-149783335 CCTGGAAGACAGAGCTGTGCAGG - Intergenic
1034267313 7:149787478-149787500 CCTGGAGCCCACAGCTGAACTGG + Intergenic
1034472976 7:151265510-151265532 CCTGAAGAGCAGAGCTGTGGGGG - Intronic
1037542912 8:19889412-19889434 CCTGGAGCCCTGAACTGTGGTGG - Intergenic
1038006015 8:23431036-23431058 CCTTGAGGCAAGAGCTGTGGGGG - Exonic
1038060223 8:23904202-23904224 CCTGGAGTACTGAGCTTTTCAGG - Intergenic
1038504783 8:28075012-28075034 TCTGGTGACCAGAGCTGTGAAGG + Intronic
1038561970 8:28588635-28588657 CCTGGAGGCCAGAGAGGTGAGGG + Intergenic
1039032692 8:33327143-33327165 CTGGGAGACCAGAGCAGTGCAGG - Intergenic
1039376987 8:37044686-37044708 CCTCAATTCCAGAGCTGTTCAGG + Intergenic
1039455629 8:37704022-37704044 CCTGGAGTCCAGGGTAGGGCAGG + Intergenic
1045289092 8:100816489-100816511 CCTGCAGTCCAGAGCTCAGGAGG + Intergenic
1045327242 8:101126476-101126498 CCTGGAGCCCGGGGCTGTGCGGG + Intergenic
1045504427 8:102768585-102768607 CCTGAAGGCCAAAGCTGTGAGGG + Intergenic
1048023377 8:130561504-130561526 CATGGAGTCCAGTGCTGTCCTGG - Intergenic
1048208066 8:132431439-132431461 CCTAGAGACCAGAGCTGGCCAGG - Intronic
1048312729 8:133338183-133338205 CCTGGAGCTCAGAGCTCTGGAGG + Intergenic
1048555537 8:135472291-135472313 CCTGGAGTTTAGAGCAGTGAAGG - Intronic
1049194469 8:141307981-141308003 CCTGGAGGCCGAGGCTGTGCGGG + Intronic
1049324504 8:142014989-142015011 GCTGGGGTCCAGGGCTGGGCGGG + Intergenic
1049813223 8:144585620-144585642 CCTAGAGTGCTGAGCTGTGGGGG - Intronic
1049959785 9:727438-727460 CCTGTAATCCAGAGCTGCTCGGG - Intronic
1050899858 9:10933482-10933504 TCTGGAGTCCAGATTTTTGCAGG + Intergenic
1051876739 9:21802086-21802108 CCTGGAGGACAGAGCTGGGATGG - Intergenic
1052460584 9:28757729-28757751 CCTGGAGTCCAGGGGTGGGAGGG + Intergenic
1052949086 9:34193511-34193533 ACTGGTGTCCAGGGGTGTGCAGG - Intronic
1052955278 9:34249226-34249248 CCTGGGTTCCTGAGCTGTCCAGG + Intronic
1053595058 9:39552219-39552241 CCTGAAGGCCAGAGGTGTGCTGG - Intergenic
1053852842 9:42307247-42307269 CCTGAAGGCCAGAGGTGTGCTGG - Intergenic
1054571196 9:66812755-66812777 CCTGAAGGCCAGAGGTGTGCTGG + Intergenic
1054915602 9:70492717-70492739 CCCCGAGTACAGAGCTGTGCAGG - Intergenic
1055574405 9:77647564-77647586 CCTGGAGCCCAGCGGGGTGCAGG - Intronic
1057712985 9:97464132-97464154 CCTGGAGGCCAGAGAAGTGAGGG - Intronic
1060776227 9:126376773-126376795 TGTAGAGTCCTGAGCTGTGCTGG + Intronic
1061135535 9:128731296-128731318 CCTGTGGTCCAGAGCGGTGGCGG + Exonic
1061391178 9:130318016-130318038 CCTGGGGGCCAGGGCTCTGCAGG + Intronic
1061591147 9:131598365-131598387 CCTGGAGGCCAAGGCAGTGCCGG + Intronic
1062195437 9:135270996-135271018 CCTGGAGACAAGAGCAGGGCTGG - Intergenic
1062238711 9:135524742-135524764 TCTGGAGGCCTGAGCTGGGCTGG - Intronic
1062351518 9:136141984-136142006 CCAGGAGGCCAGAGCTGGGCAGG - Intergenic
1062445781 9:136593656-136593678 CCTGGAGCCCAGTGCAGAGCTGG + Intergenic
1062521984 9:136961743-136961765 CCTGTGGTGCAGAGCTGAGCTGG + Intergenic
1185680560 X:1885379-1885401 CCTGGAGCCCAGCGCAGAGCTGG + Intergenic
1188980185 X:36720454-36720476 CCTGAGTTTCAGAGCTGTGCAGG + Intergenic
1189305138 X:39981338-39981360 CATGGAGTGCAGAGGTGGGCTGG + Intergenic
1189633766 X:42982962-42982984 TCTAGACTCCAGAACTGTGCTGG - Intergenic
1190498663 X:51053682-51053704 TTTGGAGCCCCGAGCTGTGCAGG + Intergenic
1190873102 X:54440928-54440950 CCTGGATTCCAGTGCTTTACGGG + Intronic
1193724131 X:85020477-85020499 CCTGGAGTCTGGAGCTGTGGGGG - Intronic
1194554261 X:95337825-95337847 CCTGGCTTCCAGACCTGTGATGG + Intergenic
1195779505 X:108445853-108445875 CCAGCAGGCCAGAACTGTGCTGG + Intronic
1197006607 X:121509926-121509948 TCTGGAGTGAAGAGCTGTGAGGG - Intergenic
1197728763 X:129793470-129793492 CCTGGACTGCAGAGCTGGCCTGG + Intronic
1199805318 X:151294124-151294146 CTTTGAATCCAGAGCTGTGTGGG - Intergenic
1200083194 X:153589520-153589542 CCTGGGGCTCAGTGCTGTGCCGG - Intronic
1200088619 X:153624092-153624114 TCTGGCTTCCAGAGCTGTGAGGG + Intergenic
1200251470 X:154556463-154556485 CCTGGGGCTCAGTGCTGTGCCGG + Intronic
1200266297 X:154647953-154647975 CCTGGGGCTCAGTGCTGTGCCGG - Intergenic