ID: 930090156

View in Genome Browser
Species Human (GRCh38)
Location 2:47525949-47525971
Sequence TCAGGGGACCCGCAGTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930090156_930090165 5 Left 930090156 2:47525949-47525971 CCCATCCACTGCGGGTCCCCTGA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 930090165 2:47525977-47525999 GTGTCAGCCCAGAGCTAGAGGGG 0: 1
1: 0
2: 1
3: 10
4: 158
930090156_930090163 3 Left 930090156 2:47525949-47525971 CCCATCCACTGCGGGTCCCCTGA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 930090163 2:47525975-47525997 ATGTGTCAGCCCAGAGCTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 137
930090156_930090164 4 Left 930090156 2:47525949-47525971 CCCATCCACTGCGGGTCCCCTGA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 930090164 2:47525976-47525998 TGTGTCAGCCCAGAGCTAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 216
930090156_930090167 9 Left 930090156 2:47525949-47525971 CCCATCCACTGCGGGTCCCCTGA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 930090167 2:47525981-47526003 CAGCCCAGAGCTAGAGGGGGAGG 0: 1
1: 0
2: 0
3: 37
4: 351
930090156_930090166 6 Left 930090156 2:47525949-47525971 CCCATCCACTGCGGGTCCCCTGA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 930090166 2:47525978-47526000 TGTCAGCCCAGAGCTAGAGGGGG 0: 1
1: 0
2: 3
3: 19
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930090156 Original CRISPR TCAGGGGACCCGCAGTGGAT GGG (reversed) Intronic
900078751 1:839005-839027 TCAGGGGCCCAGCAGTAAATTGG + Intergenic
906259875 1:44378799-44378821 GCAGGGGACCAGCTGTGGAGAGG - Intergenic
906520559 1:46464580-46464602 TCAGGGGAGCCTCTGTGGACAGG + Intergenic
911696392 1:100895049-100895071 CCTGGGCACCCGCGGTGGATGGG - Exonic
913496123 1:119429863-119429885 TCAGGGAATCCTCAGTGGGTGGG + Intergenic
916567565 1:165994538-165994560 TCAGGGGATAAGCACTGGATCGG - Intergenic
918388652 1:184036618-184036640 CCAGGGGCTCCGCAGTGGCTGGG - Intronic
919559679 1:199101340-199101362 TCAGGGGACTAGCAGTAGCTTGG - Intergenic
1075289195 10:121213898-121213920 CCAGGGGATCCCCAGCGGATGGG - Intergenic
1075949366 10:126463564-126463586 TCTGGGGACCTGCAGAGGGTGGG - Intronic
1076947403 10:133660598-133660620 TCAGGTGACACACAGTTGATGGG + Intergenic
1077076489 11:704721-704743 CCAGGTGACCCGGAGTGGATGGG + Intronic
1077385425 11:2267407-2267429 TCAGTGGACCAGCTGTGGCTTGG - Intergenic
1079354109 11:19715640-19715662 TCAGAGGACTGGCAGTGCATAGG + Intronic
1084234257 11:67776235-67776257 TTAGGGGGTCCGCAGTGCATGGG + Intergenic
1092171155 12:6374840-6374862 TCATGAGCCCCGGAGTGGATTGG + Exonic
1100443819 12:94642568-94642590 TCAGGGGACCGGCACTAAATGGG + Intronic
1101250376 12:102928537-102928559 TCAGGGGTCTCTAAGTGGATAGG - Intronic
1122666754 14:103334935-103334957 TCGGGGGACGCGCTGGGGATGGG + Intronic
1202921460 14_KI270723v1_random:33149-33171 TCAGGTGACACACAGTCGATGGG + Intergenic
1128290390 15:66474090-66474112 TCAGGGGATGAGCAGTGAATTGG + Intronic
1128469613 15:67941173-67941195 TCATGGGATCCATAGTGGATAGG + Intergenic
1131285434 15:91052985-91053007 ACAGTGGACCCGCAGTGAAAAGG - Intergenic
1132017454 15:98331387-98331409 TCAGAAGACCTGCAGTGGATAGG - Intergenic
1135075905 16:19393408-19393430 TCTGGGGACCGGCTGTGGCTGGG + Intergenic
1136112102 16:28070100-28070122 TCTGGGGACCCGCGGTCGGTTGG + Intergenic
1137442876 16:48511129-48511151 TCAGGGGCCCTGCATTGGCTGGG - Intergenic
1142881044 17:2882988-2883010 TCAGGGGGCCCACAGGGGAGGGG - Intronic
1144946268 17:18971144-18971166 ACAGGGGACCTGCCGTGGACCGG + Exonic
1149836653 17:59919094-59919116 TCAGGCCAGGCGCAGTGGATGGG - Intronic
1157220320 18:45824892-45824914 TCTGGGGACTCGCAGCTGATTGG + Intergenic
1159161297 18:64646443-64646465 TCAGGGGACCCAAAGTAGGTAGG + Intergenic
1162452990 19:10765930-10765952 TCAGGGAACCCTCAGGGGCTGGG - Intronic
1166407229 19:42529584-42529606 CCTGGGGACCCGCAGTGAACAGG - Intronic
1167658313 19:50780674-50780696 TCTGGGGACCCACAGAGGACAGG + Intergenic
929300966 2:40303358-40303380 TCAGGGGGCCAGCACTGGCTGGG + Intronic
930090156 2:47525949-47525971 TCAGGGGACCCGCAGTGGATGGG - Intronic
933042631 2:77487881-77487903 TCAGGAGACCCGAAGTGGGTAGG - Intronic
939336893 2:140841058-140841080 TCAGAGGGCTAGCAGTGGATTGG - Exonic
948166196 2:235864507-235864529 TCCGGGGCCGCGCAGTGGAGCGG - Intronic
948625758 2:239266921-239266943 TTAGGGGACCTCCAGTGGTTAGG - Intronic
1170476289 20:16718201-16718223 TCACGGGATCCCCAGTGGAGAGG + Intergenic
1172363629 20:34332438-34332460 TCAGGGTACCCGCACTTGGTGGG - Intergenic
1174807456 20:53616901-53616923 TCAGGGGAACCACAGTGGGTGGG + Intergenic
1178894536 21:36548086-36548108 GCAGGGGCCCTGCAGTGGAGGGG - Intronic
1180817790 22:18803129-18803151 TCAGGGGACCCTGAGTGAAATGG - Intergenic
1181890922 22:26062822-26062844 TCAGGGGACCTTGAGTGGTTGGG - Intergenic
1183708471 22:39489040-39489062 TGAGGGGACCAGGAGTGGGTGGG + Exonic
1184160737 22:42695758-42695780 TCAGGGGACACTCAGGGAATAGG + Intronic
1184813920 22:46856064-46856086 TCAGGGGACATGCAGAGGAAAGG - Intronic
1184899058 22:47432820-47432842 CCAGAGGACCCGCGGTGGACAGG + Intergenic
1185379065 22:50498710-50498732 TCAGGGTCCCCGCAGGTGATTGG - Intergenic
949507663 3:4742161-4742183 TCTGGAGGCCCGCAGTTGATAGG - Intronic
954139065 3:48595663-48595685 TCTGGGCACCCCCACTGGATTGG - Intergenic
957156530 3:76551356-76551378 TCAGGAGACCTGAAGTGGGTAGG - Intronic
959912523 3:111779649-111779671 CCTGGGCACCCACAGTGGATTGG + Intronic
960336043 3:116418909-116418931 TCAGGGGACTAGTAGTGAATTGG - Intronic
968321151 3:197769815-197769837 TCAGGGGACCCACAGGTGATGGG - Intronic
968321164 3:197769901-197769923 TCGGGGGACCCACAGGTGATGGG - Intronic
969820890 4:9719521-9719543 TTGGGGGGCCCGCAGTGCATGGG - Intergenic
979637833 4:122977794-122977816 TCAGGAGACCTGAAGTGGGTAGG + Intronic
985450860 4:190061398-190061420 TCAGGTGACACACAGTTGATGGG + Intergenic
985672776 5:1214788-1214810 ACAGGGGACCCTCAGTGCAAGGG + Intronic
985820587 5:2157491-2157513 CCAGGGCACTCGCAGTTGATGGG - Intergenic
986293254 5:6417200-6417222 TCAGGGGACAGGCAGGGGAAGGG + Intergenic
986685410 5:10271817-10271839 TCTGGGGAGCCTCAGCGGATGGG - Intergenic
994692910 5:103039554-103039576 TTAGGGGAGCAGTAGTGGATGGG + Intergenic
995045252 5:107639240-107639262 TCAGAGGAGCAGCAGTGAATTGG + Intronic
1004955380 6:20723048-20723070 TCTGGGTACCTGCAGTTGATGGG - Intronic
1006293918 6:33161462-33161484 TCAGGGGTCCGGTGGTGGATAGG - Intergenic
1008121431 6:47621871-47621893 TCAAGGGACCAGCAGTGGGCGGG + Intronic
1011210027 6:84945241-84945263 GCAGGGGACCCAAAGGGGATAGG - Intergenic
1013656902 6:112255289-112255311 TCAGGGGTGCCCCTGTGGATGGG + Intergenic
1016758815 6:147715753-147715775 AGAGGAGACCCACAGTGGATAGG + Intronic
1017450394 6:154549376-154549398 TCAGGAGGCCCGCAGTGGGCGGG - Intergenic
1018495908 6:164345490-164345512 TCAGGAGACCTGCAGAGGTTTGG - Intergenic
1030695382 7:112579823-112579845 TCAGGGGACCAACAGTAGATGGG + Intergenic
1031009777 7:116513866-116513888 GCAGGGGCCACGCAGGGGATGGG + Intergenic
1035526887 8:320735-320757 TCAGGGGCCCAGCAGTAAATTGG - Intergenic
1036202906 8:6784269-6784291 TTTGGGGACCTGCAGTGGGTTGG + Intergenic
1037829770 8:22180512-22180534 TATGGGGACCCGCAGGGGAGGGG - Intronic
1038427686 8:27474841-27474863 TCAGGTGAACCGCAGTGGCAAGG + Intronic
1045252395 8:100492790-100492812 TCAGGAGTCCCACAGTGGGTAGG + Intergenic
1049216442 8:141410433-141410455 TCAGGGGAGCCTGCGTGGATGGG - Intronic
1053072200 9:35108043-35108065 CCCGGGGACCCTCAGTGGATGGG + Exonic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1056972753 9:91221294-91221316 TCAGGTGAACAGCAGTGGATAGG + Intronic
1061156109 9:128862753-128862775 GCAGGGGACTGGCAGTGCATCGG + Intronic
1061250482 9:129423425-129423447 TCAGGGGACCTGCAGAGGGCCGG + Intergenic
1186813911 X:13216920-13216942 TCAGGGGAGCAGCAGTTGAGTGG - Intergenic