ID: 930092742

View in Genome Browser
Species Human (GRCh38)
Location 2:47543153-47543175
Sequence CTGTGAATAAGGAGCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930092742 Original CRISPR CTGTGAATAAGGAGCTACCA GGG Intronic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
907753365 1:57285224-57285246 CTGTGAGTAAAGAGCTAGCTTGG - Intronic
908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG + Intergenic
911269113 1:95778996-95779018 CTGTGAATAATGAGTTAGAAAGG - Intergenic
916873378 1:168941311-168941333 CTAAGAATAAGGAGGGACCAAGG - Intergenic
919587828 1:199461252-199461274 GTTTGAACAAGGAACTACCAGGG + Intergenic
921102500 1:211941902-211941924 CTGGGAATAAGGGTCTTCCAGGG + Exonic
1065988774 10:30985679-30985701 CTGTGAATAAGGAGAACCAACGG - Intronic
1070229868 10:74554095-74554117 CAGAGTATAAGAAGCTACCATGG - Intronic
1074567161 10:114590573-114590595 ATGTGAATAAGGAGAAACCCAGG + Intronic
1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG + Intronic
1080703637 11:34667678-34667700 CTGTGAATATGGGGGGACCATGG - Intergenic
1081952543 11:47057453-47057475 CTGTGAAGAAGTATCTACTAAGG + Intronic
1086045462 11:82526662-82526684 CTGTTATGATGGAGCTACCAAGG - Intergenic
1088743799 11:112787700-112787722 CTGTGAATTTGGAGCTATGATGG - Intergenic
1090737024 11:129618913-129618935 CTGGAAATAGAGAGCTACCAGGG + Intergenic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1095858713 12:46890719-46890741 TGGTGAATAAGGAGCTGTCAGGG + Intergenic
1096743573 12:53711613-53711635 CTGTGTATCAGAAGCAACCAGGG + Intronic
1097014758 12:55977774-55977796 AACTGAATAAGGAGCTACCCAGG + Intronic
1098095245 12:66947434-66947456 CAGTGATTAAGGAGAAACCAAGG - Intergenic
1098572449 12:72003965-72003987 CAGAGAATAAAGAGTTACCAAGG - Intronic
1100649799 12:96572971-96572993 CACTGAATCAGGAACTACCAAGG + Intronic
1100738193 12:97561674-97561696 CTCTGAATGAGCAGCCACCAAGG - Intergenic
1104420144 12:128628195-128628217 CTGTGAGGAAGGGGCTCCCAGGG - Intronic
1108614086 13:52114431-52114453 TTGTGAATTAGAAGCAACCAAGG - Intronic
1109641652 13:65199524-65199546 CTGTGAAGTAAGAGCTATCATGG - Intergenic
1115807510 14:37068166-37068188 CCGGGAATAAGGAGCTCCGAAGG + Intronic
1118391305 14:65298114-65298136 CTGTGGAATAGGAGCCACCAAGG - Intergenic
1118872158 14:69752503-69752525 CTGTTAAAAAGGAGATACCTGGG + Intronic
1120144010 14:80959480-80959502 CTCTGAATAAGGAGGTAGAAAGG + Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1129233652 15:74210663-74210685 CTGTGAGTAAGGAGCTGTGAAGG + Intronic
1130782038 15:87050448-87050470 CTGAGAACATGGAGCTACCTGGG - Intergenic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1135933360 16:26758187-26758209 CTGTGAACAAAGAGATGCCAAGG + Intergenic
1141438723 16:84015676-84015698 CTGCTAATAAAGACCTACCAGGG + Intronic
1143341044 17:6211148-6211170 ATCTGAATAATGAACTACCATGG + Intergenic
1144174419 17:12691288-12691310 CTGTGAAGAATGAGCGAGCATGG + Intronic
1144391785 17:14800359-14800381 CTGTGAATAGGGAGCTGTGATGG + Intergenic
1147923124 17:43930921-43930943 CTGTCAATCAGCTGCTACCAGGG + Intergenic
1150447492 17:65238511-65238533 CTGTTAAAATGGAGCTACAATGG - Intergenic
1152988463 18:340877-340899 CTGTGGACAAGGTGCTTCCAAGG - Intronic
1158124479 18:54086285-54086307 ATCTGAATAAGGAGTTTCCAAGG - Intergenic
1158907561 18:62028756-62028778 CTTAGAATATGGAGCTAACAAGG + Intergenic
1158919474 18:62174272-62174294 CAGTGAACTAGGAGCTACCATGG - Intronic
1159589301 18:70315321-70315343 AAGTGATCAAGGAGCTACCATGG - Intronic
1161366099 19:3880701-3880723 CTGGGAAGAAGCAGCTACCTCGG + Exonic
1164745868 19:30612459-30612481 CTCTGGATATGGAGATACCATGG + Intronic
1166894955 19:46017224-46017246 CTGAGAAAAAGGAGTAACCAAGG - Intronic
1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG + Intronic
925630574 2:5888808-5888830 CTGTGAAGAAGGATCTGCCCAGG + Intergenic
927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG + Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
940448752 2:153811685-153811707 CTCTAAATAAGGAGCCACAAGGG - Intergenic
945283463 2:208059513-208059535 CTGGGAATAAAGAGCTGCCTAGG + Intergenic
946032363 2:216715396-216715418 CTGGGAAGAAGGAGCTAGCTGGG + Intergenic
946545612 2:220739424-220739446 CTGTGATTCGTGAGCTACCAGGG + Intergenic
946634640 2:221711228-221711250 AAGTGAATAAGGATCTAACAGGG - Intergenic
947004955 2:225500378-225500400 TTGTGAAAAATGAACTACCAAGG - Intronic
948251278 2:236531850-236531872 CTGCCAATAAGGAGGGACCATGG - Intergenic
948771299 2:240252535-240252557 CTGTGAACACGGAGCTGCCGCGG - Intergenic
1170503419 20:16998649-16998671 ATGTGAATAGGAAGCTAGCAGGG + Intergenic
1171294349 20:24004601-24004623 CAGTGGATAAGGAGATAACAGGG - Intergenic
1172162403 20:32877843-32877865 GAGTGAATAAAGAGCTCCCAGGG + Intronic
1174768126 20:53272912-53272934 CTGAGAATGAGGGGCTACCAAGG + Intronic
1178597542 21:33968330-33968352 CTGTGTCTAAGGAGATACCCTGG + Intergenic
1181524329 22:23470807-23470829 CTGTAAAAAAGATGCTACCAAGG - Intergenic
1184311055 22:43643124-43643146 ATTTGATTGAGGAGCTACCAGGG + Intronic
949185230 3:1183251-1183273 CTGTGAATCCGAAGCTATCATGG + Intronic
950645657 3:14375058-14375080 CTGAGAATTAGGAGCTAGAATGG - Intergenic
955579232 3:60401085-60401107 CTTTAAATCAGGTGCTACCAGGG - Intronic
960996832 3:123345705-123345727 CTGTGACTGAGGAGCCACCAGGG - Intronic
963250644 3:143100046-143100068 CTTTGAATCAGGAGGAACCATGG + Intergenic
963580697 3:147123158-147123180 CTGTGCTTAAGTAGATACCAAGG + Intergenic
964653728 3:159043126-159043148 CTGAGAATAAGGGGCAACAAGGG + Intronic
965722584 3:171678003-171678025 CTGTGAATAAAGAACTCACAAGG + Intronic
967442828 3:189528591-189528613 CTATGAATAAGGAGCTAGACTGG - Intergenic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
977451706 4:97207131-97207153 CTTTGAATCAGGAGCTGCCTGGG + Intronic
979924438 4:126543050-126543072 CTGAGAATTAGGAGCTTACAGGG + Intergenic
980873366 4:138635493-138635515 CTGAGAATATGCAGCTATCATGG - Intergenic
980958661 4:139453748-139453770 CTGAGAGGAAGGAGGTACCACGG - Intronic
981471577 4:145141407-145141429 CAGTGAATAAGGTGGTACAATGG + Exonic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
984675926 4:182547784-182547806 TTTTAAATAAGGAGCTATCAAGG - Intronic
993996628 5:94730769-94730791 CTGGGAATAGGGTGTTACCAAGG - Intronic
997086891 5:130811231-130811253 CTTTGAAGAAGGAGTTTCCATGG + Intergenic
997203340 5:132026190-132026212 CTGCCAACAAGGAGTTACCAAGG - Intergenic
999595855 5:153203381-153203403 CTGTGAACTAGGACCTAACATGG + Intergenic
1003026959 6:2563688-2563710 CTGTGGATCTGGAGCTCCCATGG - Intergenic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1005873796 6:29996252-29996274 CAGTGAACCAGGAGCTACAAGGG - Intergenic
1007006950 6:38373104-38373126 TTGTGAATATGTATCTACCAAGG - Intronic
1007490094 6:42214080-42214102 CTTGGTATAAGGAGCTACCTTGG - Intronic
1015613183 6:135047980-135048002 CCCTGAATAAGGAGCTATAAAGG + Intronic
1017576349 6:155809001-155809023 TAGTGAATAATGAGATACCAGGG + Intergenic
1024246265 7:47472575-47472597 CTGTGTGTAGGGAGCTGCCAGGG - Intronic
1026528019 7:71172640-71172662 CTGTGGAGTGGGAGCTACCAGGG + Intronic
1028473696 7:91231514-91231536 CTGTGAACTAGGACCTACGATGG + Intergenic
1032356465 7:131215737-131215759 CTGTGATGATGGAGATACCATGG + Intronic
1033897513 7:146092384-146092406 CACTGAATAAGGAGTTACAAAGG - Intergenic
1036570533 8:9976359-9976381 CTGTAAATAAGGCCCTTCCAGGG + Intergenic
1037717280 8:21411127-21411149 CTGTGAGTGAGGAGCCACGATGG - Intergenic
1039243471 8:35582252-35582274 CGGTGAAATAGGAGCTATCATGG - Intronic
1039633319 8:39135951-39135973 CTGAAAATAAGAAGCAACCAGGG - Intronic
1041407237 8:57513475-57513497 CTGAGAATAAGGAGCTTCATGGG + Intergenic
1041737001 8:61121381-61121403 CGGTGAATAAGGAGCCAAGATGG - Intronic
1043126760 8:76406123-76406145 TTGTGAGTAAAGAGCTACCTTGG - Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1051470564 9:17435861-17435883 CCGTAAAAAAGGAGCTACCCTGG - Intronic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1058618869 9:106862981-106863003 CTCTGAATAATGAGCAACCAGGG - Intergenic
1058654989 9:107212163-107212185 CTCTGAATAAGCACCTAGCACGG + Intergenic
1061284453 9:129614082-129614104 CTGGCCATAAGGAGCTATCATGG - Intronic
1185956261 X:4494261-4494283 CTGTGATCAAGGAGCAACTAGGG + Intergenic
1186400549 X:9254942-9254964 CTGGGAATAAGCAGTTTCCAAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG + Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1200012871 X:153133126-153133148 CGGCAAATGAGGAGCTACCATGG - Intergenic
1200026730 X:153266791-153266813 CGGCAAATGAGGAGCTACCATGG + Intergenic