ID: 930092842

View in Genome Browser
Species Human (GRCh38)
Location 2:47543904-47543926
Sequence CACTGATGGGAGGAGGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930092831_930092842 29 Left 930092831 2:47543852-47543874 CCAAGGATTGAGACATCGCCCAC 0: 1
1: 0
2: 1
3: 6
4: 221
Right 930092842 2:47543904-47543926 CACTGATGGGAGGAGGATTGAGG 0: 1
1: 0
2: 1
3: 18
4: 240
930092832_930092842 11 Left 930092832 2:47543870-47543892 CCCACCCAGCTTCAATCCTCATA 0: 1
1: 0
2: 0
3: 15
4: 135
Right 930092842 2:47543904-47543926 CACTGATGGGAGGAGGATTGAGG 0: 1
1: 0
2: 1
3: 18
4: 240
930092834_930092842 7 Left 930092834 2:47543874-47543896 CCCAGCTTCAATCCTCATAGCTA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 930092842 2:47543904-47543926 CACTGATGGGAGGAGGATTGAGG 0: 1
1: 0
2: 1
3: 18
4: 240
930092836_930092842 -5 Left 930092836 2:47543886-47543908 CCTCATAGCTACTTCTGCCACTG 0: 1
1: 0
2: 2
3: 26
4: 196
Right 930092842 2:47543904-47543926 CACTGATGGGAGGAGGATTGAGG 0: 1
1: 0
2: 1
3: 18
4: 240
930092835_930092842 6 Left 930092835 2:47543875-47543897 CCAGCTTCAATCCTCATAGCTAC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 930092842 2:47543904-47543926 CACTGATGGGAGGAGGATTGAGG 0: 1
1: 0
2: 1
3: 18
4: 240
930092833_930092842 10 Left 930092833 2:47543871-47543893 CCACCCAGCTTCAATCCTCATAG 0: 1
1: 0
2: 3
3: 11
4: 155
Right 930092842 2:47543904-47543926 CACTGATGGGAGGAGGATTGAGG 0: 1
1: 0
2: 1
3: 18
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930092842 Original CRISPR CACTGATGGGAGGAGGATTG AGG Intronic
900888570 1:5432589-5432611 CACTCACGGGAGGTGGATGGCGG + Intergenic
902156519 1:14492092-14492114 CACTGCTGTGAGCAGGTTTGGGG + Intergenic
902875826 1:19340136-19340158 CACTTGTGGGATGAGGAATGAGG - Intronic
903292736 1:22325100-22325122 CACTGATGGGGGTAGAATGGGGG + Intergenic
903836050 1:26203887-26203909 TGCTGATGGGAGGACGATGGGGG - Intergenic
904286425 1:29455550-29455572 CACTGGAGGGAGGAGGTCTGGGG + Intergenic
904635381 1:31876847-31876869 GACTGAAGTGATGAGGATTGAGG - Intergenic
905641202 1:39591163-39591185 AAAGGATGGGAGGAGGATTCTGG + Intergenic
905856241 1:41316667-41316689 CACTGATGGGACAGGGGTTGAGG - Intergenic
909045477 1:70704224-70704246 CAGTGATGGGGGGAAGAATGGGG + Intergenic
913484014 1:119317067-119317089 TACTGATGGGAGGGCGAGTGTGG - Intergenic
917253255 1:173086215-173086237 CACTGTTGGCAGGAGAATGGAGG + Intergenic
917572881 1:176287759-176287781 CACTGATGGGAGTGGGGTGGTGG + Intergenic
918218662 1:182415700-182415722 CACTGATGGGAGAAGGGCAGTGG + Intergenic
918550648 1:185738310-185738332 GACTGAGGGGAAGATGATTGGGG - Intronic
920256807 1:204660974-204660996 CACTAATGCTTGGAGGATTGGGG + Intronic
922795031 1:228335620-228335642 CAGTGATGGGAGGAGAACAGGGG - Intronic
923824338 1:237483170-237483192 CACTGATCAGAGGAGAATTCAGG - Intronic
924209297 1:241748281-241748303 CACTCAGGGCAGGAGGACTGGGG + Intronic
924281818 1:242445821-242445843 CACTGATTGGAGGTGAAATGTGG - Intronic
1063057069 10:2517238-2517260 GACTGAGGGGAGGTGGACTGAGG - Intergenic
1063520922 10:6739893-6739915 CATTGAAGGGAGCTGGATTGAGG - Intergenic
1066194535 10:33086140-33086162 CAAGGATGGGATGAGGATTCAGG + Intergenic
1066564898 10:36711153-36711175 CAATCATAGGAGGAGGATTAGGG + Intergenic
1067309681 10:45101188-45101210 CACTGAAGCCAGAAGGATTGAGG - Intergenic
1068525208 10:58120968-58120990 CACTGAAGGGTGCAGGATGGAGG + Intergenic
1069197481 10:65570928-65570950 CACAGAGGGGAGGGGGAGTGAGG - Intergenic
1071323995 10:84493725-84493747 CACAGATGGGGAGAGGGTTGTGG + Intronic
1073024062 10:100473429-100473451 GACTGAGGGGAGGAGGAACGGGG - Intronic
1073339625 10:102735158-102735180 CACAGAGGGGAGGAGGGATGAGG - Intronic
1075231996 10:120688347-120688369 CAGTGATGAGAGGAGGACTCAGG + Intergenic
1075399542 10:122151118-122151140 CACTGCTGGGAGTTGGAGTGGGG - Intronic
1075724951 10:124606367-124606389 CACTGATGGGAGAGGGAGTGGGG - Intronic
1076934593 10:133558989-133559011 CACTGTTGGGAAGAGAATAGAGG - Intronic
1078330023 11:10411409-10411431 CAGAGTTGGGAGGAGGACTGGGG + Intronic
1078396619 11:10987392-10987414 CACAGATGGGAGGGGGGTGGGGG - Intergenic
1078924229 11:15859511-15859533 CACTGATGGGAGGACAGATGAGG - Intergenic
1080824517 11:35836829-35836851 CACTGTTGGGTGGGGGTTTGGGG - Intergenic
1083961267 11:66016240-66016262 CACTGAGGGGAGGTGGAGTCGGG - Intergenic
1085218145 11:74850118-74850140 CTTTGATGGGAGGAGGTGTGAGG + Intronic
1085463434 11:76708822-76708844 CACTCATGAGAGGAGGATCCCGG - Intergenic
1090082997 11:123626780-123626802 CACAGAGGTGAAGAGGATTGGGG - Intronic
1090888160 11:130897671-130897693 CATTGATGGTAGGGGGTTTGGGG - Intronic
1091767338 12:3130182-3130204 CACTGAGGGCAGGAGGAATCAGG - Intronic
1093428127 12:19052399-19052421 GACTGATAGGAGGAGGGATGAGG - Intergenic
1094078905 12:26511180-26511202 CACTGATGGGATGATACTTGTGG - Intronic
1094402298 12:30075002-30075024 CACTAATGGGAAGAGGAAGGAGG + Intergenic
1098820615 12:75222971-75222993 ATCTGATGGGAAGAGGGTTGAGG - Intergenic
1100165524 12:91913150-91913172 CATTGATGGGAGGTAGATGGTGG - Intergenic
1101375560 12:104168406-104168428 CACAGATGGGAGCAGGATGGGGG - Intergenic
1102171098 12:110843036-110843058 CACAGAAGGAAGGAGGATTGGGG + Intergenic
1103173424 12:118842044-118842066 CACTGATCAAAGGAGGTTTGAGG - Intergenic
1103353700 12:120303901-120303923 GGCTGGTGGGAGGAGAATTGAGG - Exonic
1105454051 13:20524860-20524882 CACTGATGGGGGGCGGAGTCGGG + Intronic
1105795124 13:23843996-23844018 CAATGATGGGAGGAGGATGGAGG + Intronic
1106442370 13:29787967-29787989 CACTAATGGGAGGTGGACAGAGG - Intronic
1109563103 13:64077533-64077555 CACTCAAGGGATGAGGAGTGCGG - Intergenic
1111121160 13:83851503-83851525 TACTTATGGGAGGAGGGTTATGG - Intergenic
1113581524 13:111433439-111433461 GACTGGAGGGAGGAGGGTTGTGG - Intergenic
1118477184 14:66128501-66128523 CACAGATGGGTGGGGGAGTGTGG - Intergenic
1118844614 14:69537758-69537780 CACTGATGGCAGGAAGAAGGTGG + Intergenic
1121060696 14:90906733-90906755 CACTCAGGGGAAGAGGAGTGAGG - Intronic
1122210557 14:100171145-100171167 CACTGATGGGAAGAAGATGTTGG + Intergenic
1122778642 14:104134381-104134403 CACTGAAGGGACGTGGATGGGGG + Intergenic
1123821256 15:24032526-24032548 CACTGAAGGGATGGGGAATGAGG - Intergenic
1124210853 15:27763988-27764010 CACTGAGGGGTGGGGGTTTGGGG + Intronic
1125412037 15:39415950-39415972 CACAGGTGTGAGGAGGGTTGGGG - Intergenic
1126346591 15:47701356-47701378 AGCTGAGGGGAGGGGGATTGGGG + Intronic
1126739065 15:51759800-51759822 CAAAGATGGGGGGAGGATTTAGG + Intronic
1127130273 15:55855199-55855221 CACTCATGGGATGAGGATTTTGG + Intronic
1127930725 15:63595581-63595603 CATTGGTTTGAGGAGGATTGGGG + Intergenic
1128444357 15:67743882-67743904 CACTGAAGGGAGGGGGCTTCTGG + Intronic
1128652993 15:69433618-69433640 CACAGATGGGTTGAGGCTTGAGG - Intronic
1131157763 15:90085325-90085347 CCCTGATGGGAAGACGATTGAGG - Exonic
1131434352 15:92411338-92411360 CACCCATGGGAGTAGCATTGAGG + Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133620814 16:7524619-7524641 CCCTGATTGGAGAAGGAATGTGG + Intronic
1136924852 16:34362448-34362470 CACAGTTGGGAGGAAGGTTGGGG - Intergenic
1136979721 16:35049358-35049380 CACAGTTGGGAGGAAGGTTGGGG + Intergenic
1137582078 16:49639662-49639684 CAGTGATTGGAGGATGAATGAGG + Intronic
1138545688 16:57718161-57718183 CCCTGTTGGGATGAGGAGTGTGG + Intronic
1138684389 16:58711946-58711968 CACGAATGTGAGGAGGACTGTGG - Intronic
1140456922 16:75111134-75111156 AGCTGATGGGAGGAGGAGAGGGG + Intergenic
1141493911 16:84393689-84393711 CAAAGAGGGGAGGAGGATAGAGG + Intronic
1142008506 16:87701775-87701797 CACAGACGGGAGAAGGATGGCGG - Intronic
1142532206 17:587978-588000 CAGGGGTGGGAGGAGGCTTGGGG - Intronic
1143270627 17:5672291-5672313 CACTCGTGTGAGGAGCATTGAGG - Intergenic
1143860384 17:9886242-9886264 CACTGATAGCAGGAGGCTGGTGG - Intronic
1143997183 17:11016968-11016990 CCTTGATGGGAGGAGGATTCTGG + Intergenic
1146452283 17:32984149-32984171 CATTGTTGGCAGGAGGACTGTGG - Intronic
1146790667 17:35748836-35748858 CCCTGATGGGAGGAGGAGATAGG + Intronic
1146974595 17:37099685-37099707 GGCTGATGGGAGGAGGGCTGAGG + Intronic
1148236753 17:45974283-45974305 CAATGCAGGGAGGAGGAGTGAGG - Intronic
1149451678 17:56754616-56754638 CACTGCTGGGAGGTGCATTTAGG + Intergenic
1149470425 17:56911653-56911675 CTAAGATGGGAGAAGGATTGAGG + Intronic
1149547874 17:57517841-57517863 CTCTGATGGGAGGTGGACTCTGG - Intronic
1150610195 17:66727431-66727453 CACTGGTGGGTAGAGGATTGAGG + Intronic
1150707689 17:67502531-67502553 CACTGGATGGAAGAGGATTGGGG + Intronic
1151348671 17:73518804-73518826 CACTGAGGGGAAGAGGACTGTGG - Intronic
1152648788 17:81482443-81482465 CAGTGCTGGGAGGGGGACTGAGG - Intergenic
1152900722 17:82939566-82939588 CTCTGATAGGAGGAGGAAAGAGG + Intronic
1153499072 18:5730140-5730162 CTCTGCTGGGCGGAGGATTCTGG - Intergenic
1153677098 18:7465502-7465524 CACAGATGGGGGGAGGGTTGTGG + Intergenic
1157402553 18:47400551-47400573 CCCGGGTGGGAGGATGATTGTGG - Intergenic
1157402799 18:47401512-47401534 CCCCGGTGGGAGGATGATTGTGG - Intergenic
1157402829 18:47401634-47401656 CCCGGGTGGGAGGATGATTGCGG - Intergenic
1157402840 18:47401676-47401698 CCCGGGTGGGAGGATGATTGTGG - Intergenic
1157402884 18:47401843-47401865 CCCGGGTGGGAGGATGATTGTGG - Intergenic
1157402916 18:47401969-47401991 CCCGGGTGGGAGGATGATTGTGG - Intergenic
1157402938 18:47402053-47402075 CCCGGGTGGGAGGATGATTGTGG - Intergenic
1157403014 18:47402345-47402367 CCCGGGTGGGAGGATGATTGTGG - Intergenic
1157403060 18:47402513-47402535 CCCGGGTGGGAGGATGATTGTGG - Intergenic
1157403071 18:47402555-47402577 CCCGGGTGGGAGGATGATTGTGG - Intergenic
1157403082 18:47402597-47402619 CCCGGGTGGGAGGATGATTGTGG - Intergenic
1157403094 18:47402639-47402661 CCCGGCTGGGAGGATGATTGTGG - Intergenic
1157403146 18:47402848-47402870 CCCAGGTGGGAGGATGATTGTGG - Intergenic
1157403168 18:47402931-47402953 CCCCGGTGGGAGGATGATTGTGG - Intergenic
1157823024 18:50787854-50787876 GACTGATGGGTGCAGGAATGGGG - Intergenic
1158193964 18:54863666-54863688 GGCTGGTGAGAGGAGGATTGGGG - Intronic
1160377176 18:78421829-78421851 AACTGGTGGGTGGAGGGTTGGGG + Intergenic
1163448728 19:17362993-17363015 TACGGCTGGGATGAGGATTGGGG - Intronic
1166179076 19:41094496-41094518 CACTAATGGGGGCAGGATTCTGG - Intronic
1166257225 19:41615186-41615208 CACAGATATGAGGAGGAGTGGGG + Intronic
1167316917 19:48769266-48769288 AGCTGAAGGGAGGAGAATTGGGG - Intergenic
926332650 2:11838075-11838097 CACTAAAGGGAGGAGGAGTGGGG + Intergenic
926911240 2:17853475-17853497 GACTGATGGGACCTGGATTGGGG - Intergenic
929473936 2:42226251-42226273 CACTGAAGGGACAGGGATTGGGG + Intronic
930092842 2:47543904-47543926 CACTGATGGGAGGAGGATTGAGG + Intronic
932271361 2:70413059-70413081 CTCTGTAGGGAGGAGGATGGAGG + Intergenic
932838996 2:75064210-75064232 GACTGAAGGGAGGAGGAGTGTGG - Intronic
935608082 2:104990790-104990812 TACTGATAGGAGGAAGAATGAGG + Intergenic
935687548 2:105697694-105697716 CAGTGTTGGGAGGAGAATTCTGG - Intergenic
937501987 2:122489198-122489220 CACTGATGTGAGAATGGTTGAGG + Intergenic
938926206 2:136044996-136045018 GACTGGTGGGAGGAAGAATGGGG + Intergenic
946420697 2:219562973-219562995 AACTGATGAGAGGAGGGTTGGGG + Intronic
1169427903 20:5510547-5510569 CAGGGAGGGGCGGAGGATTGGGG + Intergenic
1170060072 20:12249712-12249734 TACTGATTGGAGGAGCATTCTGG - Intergenic
1171423381 20:25033813-25033835 GGCTGTTGGGAGGAGGACTGGGG + Intronic
1172530320 20:35626499-35626521 CCCTGATGTGAGTAGGGTTGAGG - Intronic
1172934082 20:38607232-38607254 CAATGATGAGTGGAGGATTTAGG - Intronic
1173834064 20:46113624-46113646 CCCTGATGGGTGGTGGACTGTGG + Intergenic
1175267773 20:57712964-57712986 CACTGCTGGGAGTGGGAGTGGGG + Intergenic
1178343064 21:31802268-31802290 CACTGTTGGGATGGGGGTTGGGG - Intergenic
1178417385 21:32414807-32414829 CACTGATGAGAGGAAAAATGGGG - Intronic
1178621905 21:34184634-34184656 CCGTGATGGGAAGAGGTTTGCGG + Intergenic
1183453661 22:37909961-37909983 CTCTGCTGGGACGAGGGTTGTGG + Intronic
1184428627 22:44428183-44428205 CCCTGGTGGGGGTAGGATTGGGG - Intergenic
1185023250 22:48392915-48392937 CACTGATGGGTGGAGGAGGGAGG + Intergenic
1185415030 22:50705164-50705186 CAGGGATGGGAAGAGGAATGTGG - Intergenic
949131123 3:502530-502552 CAGTCATGGGAGGAAGAATGGGG - Intergenic
949750297 3:7344729-7344751 CACTGAAGGGAGTAGAATAGTGG + Intronic
949981280 3:9503212-9503234 CACTGAAGGGAGGAAAACTGGGG + Intronic
950672668 3:14536580-14536602 CCCTGTGTGGAGGAGGATTGTGG - Intronic
951227848 3:20142048-20142070 TGCTGCTGGGAGGAGGAATGAGG - Intronic
951350728 3:21603824-21603846 CAGGGATGGTAGAAGGATTGTGG + Intronic
951723168 3:25723901-25723923 CACTGGTGGGAGGAGGGGTTGGG - Intronic
951865831 3:27306250-27306272 CAAGGATGGGAGGAGCAGTGGGG - Intronic
951925049 3:27900392-27900414 CACTGATGAGCGCAGGGTTGTGG + Intergenic
952388398 3:32859783-32859805 CACTGGTGGGAAGAGGGATGGGG + Intronic
952838423 3:37624489-37624511 GACTGATGGGTGCAGGACTGGGG - Intronic
952930299 3:38355003-38355025 CAGGGATGGGTGGAGTATTGTGG - Intronic
954144499 3:48627812-48627834 CGCCGATGGCAGGAGGAGTGGGG - Intronic
954342331 3:49965243-49965265 CACTCATGGGATGAGGACTGAGG - Intronic
955422106 3:58748950-58748972 CAGTGTTGGGAGGAGGTATGAGG + Intronic
962074844 3:132070776-132070798 CACTGAGGAGAGGAGCAGTGTGG - Intronic
962095577 3:132289326-132289348 CATTGATGGGAGGAACAGTGGGG - Intergenic
962455382 3:135560586-135560608 GTCTGATGGGAGGAGGCATGAGG - Intergenic
965285324 3:166811928-166811950 CACTACTGGGAAGAGGACTGTGG - Intergenic
966400818 3:179545446-179545468 CACTGCTGGAAGGAAGATGGGGG - Intergenic
967975064 3:195029752-195029774 CACAGAGGTGAGGAGGATTCAGG - Intergenic
969499072 4:7542146-7542168 CCCTCATGGGCGGAGGGTTGGGG + Intronic
969604715 4:8196711-8196733 CCCTGATGGGAGAAGGAAGGTGG + Intronic
975894490 4:79071923-79071945 CACTGATGGGGTGAGGGATGTGG - Intergenic
978940878 4:114434796-114434818 CACAGTGGGGAGGAGGAATGGGG + Intergenic
979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG + Intergenic
981279742 4:142944081-142944103 TACTGATGGGAGGATGGGTGTGG - Intergenic
982550132 4:156787346-156787368 GTCTGATAAGAGGAGGATTGAGG + Intronic
983280747 4:165678073-165678095 AACTGATGGGAGGAGTGCTGAGG + Intergenic
984957347 4:185058499-185058521 CAGAGATGTGAGCAGGATTGAGG - Intergenic
985590649 5:762984-763006 TACAGATGGGAAAAGGATTGTGG + Intronic
986775025 5:11006430-11006452 CACAGATGGAAGGAGGAGTCTGG + Intronic
987063284 5:14262791-14262813 CACTGTGGGGAGCAGGTTTGTGG + Intronic
988497887 5:31760054-31760076 AGCAGATGGGAGGAGGAGTGGGG + Intronic
988731824 5:33980209-33980231 CACTGATTGGAGTAGGAGGGGGG - Intronic
997696429 5:135864608-135864630 GAGTGAAGGGAGGAGGTTTGTGG + Intronic
998149855 5:139750697-139750719 CACTGATGGGATGATGGTTCAGG + Intergenic
1000265270 5:159630225-159630247 CACGGAGGGGAGGAAGGTTGTGG - Intergenic
1001789941 5:174447477-174447499 CACTGAAGAGAGGAGGACAGAGG + Intergenic
1001866622 5:175111647-175111669 CACTGAAGGGAGGATAATTATGG + Intergenic
1002025132 5:176391682-176391704 ACCTGATGGGGGCAGGATTGGGG + Intronic
1002035607 5:176467029-176467051 CTCTGAAGGGAGGAGGAAGGAGG + Intronic
1002110116 5:176903076-176903098 CACTGAGGGGTGGAGGGATGGGG - Intergenic
1003290318 6:4775082-4775104 AACTGGTGGGAGGAGCCTTGTGG + Intronic
1004139829 6:13007698-13007720 CACTGATGAGAAGAGGGCTGGGG - Intronic
1005077996 6:21927291-21927313 AACTCCTGGCAGGAGGATTGAGG - Intergenic
1005941011 6:30559911-30559933 CACTGATGGAAGGATAAATGTGG + Intronic
1006978096 6:38122559-38122581 CAGTGGTGGGGGGAGGATTTGGG + Intronic
1007766669 6:44164714-44164736 CAAGGATGGGAAGAGGAATGAGG + Intronic
1007926706 6:45655550-45655572 CAGGCATGGGAGGAGGACTGAGG - Intronic
1011706070 6:90002816-90002838 GACTGAGAGGAGTAGGATTGGGG - Intronic
1013197048 6:107853405-107853427 CTGGGATGGGAGGAGGAATGGGG - Intergenic
1014266730 6:119286407-119286429 CACAGAGGGGAGTAGGATTGTGG - Intronic
1016162013 6:140894120-140894142 CACTGGTTGGCGTAGGATTGAGG - Intergenic
1016429598 6:143968848-143968870 GACTGATGGCAGGAGCACTGGGG + Intronic
1017343569 6:153354477-153354499 AACTAGTGGTAGGAGGATTGTGG + Intergenic
1018416016 6:163602874-163602896 CGCTGCAGGGAGGAGGATTCTGG - Intergenic
1018768378 6:166951926-166951948 CACAGATGGGAGGAGGGGTTAGG - Intronic
1020112091 7:5453033-5453055 CACTGCTGGGAGGAAGAGAGGGG - Intronic
1020427500 7:8085744-8085766 CACAGATGGGGGGTGGAGTGGGG - Intronic
1020458782 7:8404528-8404550 TACTGAAGGGAGGGGGAATGGGG + Intergenic
1022658574 7:32344662-32344684 CAGGGATTGGAGGAGGACTGGGG - Intergenic
1024212326 7:47216629-47216651 CACTCATGGGAGGAGGAGACAGG - Intergenic
1026902242 7:74043711-74043733 AACTCGTGGGAGGAGGGTTGTGG + Intronic
1027962509 7:84964652-84964674 GACTGATGGGTGGAAGATTCAGG + Intergenic
1028893232 7:96012051-96012073 CGTTGGTGGGAGGAGGGTTGGGG + Intronic
1029707803 7:102284960-102284982 CCCTGAGGGCAGGAGGCTTGAGG - Intergenic
1031341588 7:120609308-120609330 CACTGATGAGAGGCGGGATGGGG + Intronic
1032002690 7:128275696-128275718 CACTGATTGTGGGAGGAGTGGGG + Intergenic
1032002898 7:128276758-128276780 CTCAGAAGGGAGGAGGGTTGGGG + Intergenic
1033339095 7:140478597-140478619 CACAGTTGGGCGGAGGATGGGGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034695614 7:153050731-153050753 CATTGAAGGGTGGAGGACTGGGG - Intergenic
1034978448 7:155461123-155461145 CACTGAGGAGAAGAGGAATGTGG - Intronic
1037190397 8:16117938-16117960 CAGGGATGGGAGAAGGTTTGGGG - Intronic
1037388239 8:18365501-18365523 GACTGAGGGCAGCAGGATTGAGG - Intergenic
1038586783 8:28796831-28796853 GACTGATGGGAGGAGGCAAGAGG + Intronic
1039429069 8:37511608-37511630 CACTGCTTGGATGAGGACTGAGG - Intergenic
1041144080 8:54853473-54853495 CAGTGATGGGAGCAGCCTTGGGG + Intergenic
1042258270 8:66829238-66829260 CATGGATTGGAGGAGGAATGTGG + Intronic
1042575485 8:70213614-70213636 CAGTGTGGGGAGGAGAATTGTGG + Intronic
1043776133 8:84271814-84271836 CTGTGCTGGGAGGAGGAGTGGGG + Intronic
1045325252 8:101112962-101112984 CATTGAGGGCAGGAGGATTAGGG - Intergenic
1045657823 8:104405355-104405377 CACTGATGGCTGGAGTACTGGGG - Intronic
1045863272 8:106837018-106837040 CACAGCTGGGAGGAGGTTTCAGG + Intergenic
1047115570 8:121838060-121838082 CATTAATGGGAGCAGGATTTGGG + Intergenic
1049591549 8:143465154-143465176 CACTGCTGGGTGGAGAATTGGGG - Intronic
1049917921 9:336379-336401 CTCTGGTCGGAGGAGGATTAAGG + Intronic
1051172779 9:14336321-14336343 CCCTGAAGGGAGTGGGATTGTGG + Intronic
1056572367 9:87826734-87826756 CACTAGTGGGTGGAGGATAGGGG - Intergenic
1058199275 9:102018687-102018709 TCCTCATGGGATGAGGATTGTGG - Intergenic
1058328878 9:103733991-103734013 CTCTGATAGGATGAGGAGTGGGG + Intergenic
1061150543 9:128825678-128825700 CTCTGATTTGAGGAGGCTTGAGG + Intronic
1061503040 9:131014487-131014509 CTCTGGTGGAAGGAGGATTAGGG - Intronic
1062008279 9:134252675-134252697 CACTGCTGGGAGGAGGAAAGCGG + Intergenic
1062322766 9:135998446-135998468 CACCCAGGGGAGGAGGAATGGGG - Intergenic
1187573717 X:20532122-20532144 CAAAGGTGGGAGGAGGAGTGGGG + Intergenic
1188105887 X:26146169-26146191 CTCTGATGGGAGGAGGGCTGAGG - Intergenic
1188868675 X:35346770-35346792 CACTGATGGTAAGAAGACTGTGG + Intergenic
1189028108 X:37420300-37420322 CATTGATGGGGGGAGCCTTGTGG - Intronic
1191871151 X:65746692-65746714 TACTGAGGTGAGGAAGATTGAGG - Intergenic
1192190948 X:68990860-68990882 CACTGACAGGAGGGGGACTGGGG + Intergenic
1194299608 X:92169393-92169415 ATCTGTTGGGAGCAGGATTGTGG - Intronic
1194819508 X:98488627-98488649 CACTGATGGTAGGTGGAATATGG + Intergenic
1195652428 X:107299312-107299334 CAGTGAGGGGTGGAGGGTTGGGG + Intergenic
1197266622 X:124380922-124380944 CACTGGGGGGAGGCGGATTCTGG - Exonic
1197273927 X:124455961-124455983 CTCTGATGGGATGAGAAGTGTGG - Intronic
1198840689 X:140854174-140854196 CATTGAAGGCAGGAGGAATGTGG + Intergenic
1199274503 X:145925752-145925774 CAGTGGTGGGAGAAGGGTTGGGG - Intergenic
1200280812 X:154775479-154775501 ATCTGCTGGGAGGAGGAATGTGG + Intronic
1200617252 Y:5394554-5394576 ATCTGTTGGGAGCAGGATTGTGG - Intronic